Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: UNIPROT:Q07644 (polypeptide)
72,197 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

In human saliva, two different mucin populations can be distinguished, viz., high-molecular-weight mucins (MG1, mol. wt > 1 x 10(6)) and low-molecular-weight mucins (MG2, mol. wt approximately 125 kD). The carbohydrate moiety of MG1 displays a wide spectrum of oligosaccharide structures, varying in composition, length, branching, and acidity. The biological significance of the heterogeneity in carbohydrate structures of mucins is unclear. The present investigation focused on the question whether MG1, because of its diverse carbohydrate side-chain population, can bind to a large variety of oral micro-organisms. A replica plate technique, in combination with immunochemical detection with monoclonal antibodies against MG1, was used to screen in vivo human oral microflora for the presence of micro-organisms which could bind the high-molecular-weight salivary mucin MG1. Binding to purified MG1 was established for Hemophilus (para)influenzae species, whereas other species, including Streptococcus and Staphylococcus, were negative. MG1 binding to Hemophilus parainfluenzae could be abolished by protease treatment of MG1. In contrast, periodate acid treatment, partial deglycosylation, or addition of monosaccharides did not affect MG1 binding to H. parainfluenzae, indicating that MG1 carbohydrate side-chains were not directly involved in the binding. The binding was pH-dependent, showing an increase when the pH was lowered from 8.0 to 4.0. These data indicate that MG1 can be bound in a selective manner by Hemophilus spp. and suggest that the 'naked' unglycosylated polypeptide moiety of MG1 is involved in its binding to Hemophilus parainfluenzae.
...
PMID:Binding of human high-molecular-weight salivary mucins (MG1) to Hemophilus parainfluenzae. 787 29

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.
...
PMID:A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization. 800 30

Tracheobronchial mucins from lung mucus secretions of healthy individuals and from patients with cystic fibrosis (CF) were purified according to a protocol established in our laboratory. Following digestion of the purified, reduced-alkylated mucin (free of 118 kDa and 70 kDa components) with trypsin-L-1-tosylamido-2-phenylethyl chloromethyl ketone, three fractions (TR-1, TR-2 and TR-3) were observed upon chromatography on a Superose 6 column using FPLC. TR-1 (glycosylated fraction) contained all of the carbohydrate, while TR-2 and TR-3 fractions had no detectable sugars. Comparison of the amino acid composition of TR-1 fractions from normal and CF individuals revealed no significant differences, while the TR-2 fractions from these mucins showed noticeable differences. Peptide mapping of TR-2 fractions from normal and CF mucins was performed on a C18 reverse phase column using FPLC. The peptide maps of normal mucins were markedly different from CF mucins. A greater number of peptides were seen in the TR-2 fractions of normal mucins when compared to CF mucin TR-2 fractions. In addition, normal TR-2 fractions appeared to be comprised of more hydrophobic peptides when compared to CF TR-2 fractions. These data provide evidence of possible structural differences in the non-glycosylated regions of CF and non-CF mucins, since the TR-2 fractions are essentially derived from the T-domains in the "naked" stretches of the mucin polypeptide backbone.
...
PMID:Peptide mapping reveals differences in the non-glycosylated domains of cystic fibrosis and normal tracheobronchial mucins. 800 22

Synthetic peptides corresponding to the human mucin MUC1 tandem repeat domain (20 residues) were glycosylated in vitro by using UDP-N-[3H]acetyl-D-galactosamine (GalNAc) and lysates of pancreatic tumor cell lines. Results obtained with peptides of different lengths (from one to five repeats) suggest that increasing the number of tandem repeats has neither a positive nor a negative effect on the density of glycosylation along the MUC1 tandem repeat protein backbone. Purified glycopeptides were sequenced on a gas-phase sequencer, and glycosylated positions were determined by measuring the incorporated radioactivity in fractions collected following each round of Edman degradation. The results showed that two of three threonine residues on the MUC1 tandem repeat peptides were glycosylated by pancreatic tumor cell lysates at the following positons: GVTSAPDTRPAPGSTAPPAH (underlined T indicates position of GalNAc attachment). None of the serine residues were glycosylated. Determination of the mass of the glycopeptides by mass spectrometry confirmed that a maximum of two molecules of GalNAc were covalently linked to each 20-residue repeat unit in the peptides. The data presented here show that acceptor substrate specificity of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase detected in lysates of pancreatic and breast tumor cell lines is identical and is limited to some but not all threonines in the MUC1 tandem repeat peptide sequence. The influence of primary amino acid sequence on acceptor substrate activity was evaluated by using several peptides that contain single or double amino acid substitutions (relative to the native human MUC1 sequence). These included substitutions in the residues that were glycosylated and substitutions of the surrounding primary amino acid sequence. The results of these studies suggest that primary amino acid sequence, length, and relative position of the residue to be glycosylated dramatically affect the ability of peptides to serve as acceptor substrates for the UDP-GalNAc:polypeptide N-acetylgalatosaminyltransferase.
...
PMID:N-acetylgalactosamine glycosylation of MUC1 tandem repeat peptides by pancreatic tumor cell extracts. 803 93

Trans-sialidase catalyzes the transference of sialic acid from host to the Trypanosoma cruzi surface. Here, we characterize the sialic acid acceptors of this protozoan parasite as mucin-like molecules, which are anchored to the membrane by glycosylphosphatidylinositol. The mucins isolated from the insect stages differ from the mucins isolated from the mammalian stages in size and reactivity to monoclonal antibodies, suggesting that they are formed by variable polypeptide chains and/or O-linked carbohydrate structures.
...
PMID:Sialic acid acceptors of different stages of Trypanosoma cruzi are mucin-like glycoproteins linked to the parasite membrane by GPI anchors. 808 Dec 62

In this study, we investigated the biochemical basis for the induction of sialomucin production in HT-29 LMM human colon carcinoma cells. Previous studies showed that conditioned medium from organ cultures of normal human colonic connective tissues (NCCM) stimulated the biosynthesis of high molecular weight sialoglycoproteins (M(r) 740,000 and 450,000) by colon carcinoma cells in vitro. Using monoclonal antibodies specific for human milk mucin, we determined that the polypeptide core of these sialomucins was the polymorphic epithelial mucin core peptide coded by the MUC1 gene. Northern analysis showed that cells treated with NCCM expressed a higher level of MUC1 poly(A)+ mRNA than untreated cells. The UDP-GalNAC: polypeptide N-acetylgalactosaminyltransferase activity in microsomal fractions from these cells did not change upon NCCM treatment. The ratios of oligosaccharides with various negative charges secreted by HT-29 LMM cells in the presence of benzyl-alpha-D-N-acetylgalactosaminide were not affected by NCCM treatment indicating that the degree of sialylation of O-linked carbohydrate chains is not influenced by NCCM treatment. [3H]Glucosamine pulse-chase labeling studies using antibodies specific for a COOH-terminal unglycosylated region of the MUC1 mucin core peptides suggested that NCCM treatment of HT-29 LMM cells did not change the rate of MUC1-related sialomucin processing.
...
PMID:Regulation of sialomucin production in colon carcinoma cells. 809 36

Recently we described the isolation of a mouse cDNA clone encoding a mucin-like endothelial glycoprotein that appears to function as an adhesive ligand for L selectin. This ligand has been named GlyCAM 1 (Gly-cosylation-dependent Cell Adhesion Molecule 1) because its adhesive interactions with the L selectin lectin domain require that the GlyCAM 1 polypeptide chain be appropriately modified with carbohydrates. These carbohydrate modifications include the addition of sialic acid as well as sulfate residues to O-linked carbohydrate side chains that are clustered in two serine/threonine-rich domains of the mucin. An additional interesting structure that may have relevance to the association of GlyCAM 1 with the lumenal surface of the endothelium was a potential amphipathic helix at the C terminus of the glycoprotein. In order to examine the importance of the postulated O-linked domains as well as the potential amphipathic helix, we have cloned the rat homologue of GlyCAM 1. The sequence of this clone reveals a serine/threonine-rich protein that is highly homologous with the mouse GlyCAM 1. As was found for the mouse GlyCAM 1, the rat homologue shows a clustering of these potential O-linked carbohydrate acceptors in two domains of the protein. Interestingly, many of the serines and threonines are found to be spaced identically in the two homologues, consistent with the possibility that both density and position of the O-linked side chains may be important for appropriate L selectin-mediated adhesion. In support of its postulated functional importance, the C-terminal potential amphipathic helix is conserved in the rat homologue. Finally, immunoprecipitation analysis of [35S]sulfate-labeled rat lymph nodes with either a mouse L selectin IgG chimera or a peptide antiserum directed against a relatively conserved portion of mouse GlyCAM 1 demonstrates a approximately 45-kDa sulfated ligand in rat lymph nodes that is analogous to that previously described for mouse lymph nodes.
...
PMID:Cloning of a rat homologue of mouse GlyCAM 1 reveals conservation of structural domains. 810 Feb 29

Ascites sublines of the highly metastatic 13762 rat mammary adenocarcinoma contain abundant amounts of a heterodimeric cell surface glycoprotein complex composed of a mucin subunit ASGP-1 (ascites sialoglycoprotein-1) and a transmembrane subunit (ASGP-2). Previous studies showed that the complex is synthesized from a single polypeptide encoded by a 9 kb transcript. The sequence of the transmembrane subunit was obtained from a 5-kilobase (kb) cDNA isolated from a plasmid library (Sheng, Z., Wu, K., Carraway, K. L., and Fregien, N. (1992) J. Biol. Chem. 267, 16341-16346). Completion of the sequence of this cDNA revealed the C-terminal domain of ASGP-1, which is rich in serine and threonine but contains no typical mucin-type repeats. The remainder of the sequence of ASGP-1 and the 9-kb transcript was obtained by two 5'-RACE (rapid amplification of cDNA ends) steps and primer extension analysis. These results revealed that the 5' half of the 9-kb transcript contains a short 5'-noncoding region and encodes a signal sequence, a short nonrepeat region, and a repeat domain containing 11 repeats. Nine of these repeats are found in tandem, but the two end repeats are separated from the others by short unique sequences. The repeats vary from 117-124 amino acids and are 70-90% identical to a consensus sequence. Overall, the sequence predicts that ASGP-1 contains 2172 amino acids (M(r) 224,190), 43% of which are serine and threonine. We propose that the complex of this mucin and its transmembrane subunit, which contains growth factor-modulating activity, may play an important role in tumor progression.
...
PMID:Molecular cloning and sequencing of the mucin subunit of a heterodimeric, bifunctional cell surface glycoprotein complex of ascites rat mammary adenocarcinoma cells. 816 96

We have investigated a mechanism of the regulation of mucin core polypeptide (MUC1) gene expression, which is induced by a soluble stimulatory factor, in KM12C human colon carcinoma cells. Conditioned media from normal human colon tissues elevated the level of expression of MUC1 mRNA. Transcriptional activation of the MUC1 gene was analyzed by transient expression of MUC1-CAT reporter plasmids containing the 5'-flanking sequence of the MUC1 gene fused to the bacterial chloramphenicol acetyltransferase (CAT) gene. A region between base pairs -531 and -520 of the 5'-flanking sequence of the MUC1 gene was sufficient for the induction of CAT activity by normal colon conditioned medium (NCCM). Mutagenesis of 3 base pairs within the region corresponding to sequence -531 to -517 from ACAGGGAGCGGTTAG to ACAGGGAGATTTTAG substantially decreased the induction of CAT activity by NCCM. Nuclear extracts from untreated or NCCM-treated KM12C cells were tested for their interaction with 32P-labeled oligonucleotides corresponding to this sequence. A specifically retarded band was identified after electrophoretic analysis. The quantity or mobility of this band was not changed by NCCM treatment. When an oligonucleotide with three point mutations was used as a competitor, the retarded band remained at the same position. This element (positions -531 to -520), which we call the responsive mucin element, does not contain any sequence that corresponds to previously described cis-acting elements. A protein component complexed with this sequence was identified with a molecular mass of approximately 70 kDa by SDS-polyacrylamide gel electrophoresis.
...
PMID:Transcriptional regulation of the MUC1 mucin gene in colon carcinoma cells by a soluble factor. Identification of a regulatory element. 819 40

Synthetic peptides (30 and 20 residues long) corresponding to the native MUC1 tandem repeat sequence (20 residues long) were glycosylated in vitro using UDP-[3H]GalNAc and lysates from the human breast tumor cell line MCF7. Purified glycopeptides were sequenced on a gas-phase sequenator, and glycosylated positions were determined by measuring the incorporated radioactivity in fractions collected following each round of Edman degradation. The results showed that 2 of 3 threonines on the MUC1 tandem repeat peptides were glycosylated at the following positions: GVTSAPDTRPAPGSTAPPAH (underlined Thr residues indicate positions of GalNAc attachment); no glycosylation of serine residues was detected. Determination of the mass of the glycopeptides by mass spectrometry showed that a maximum of two molecules of GalNAc were covalently linked to each 20-residue repeat unit in the peptides. The influence of substrate primary amino acid sequence in determining the substrate specificity of UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyl-transferase activity was evaluated using as acceptor substrates a series of overlapping 9-residue peptides that represent a moving set through the tandem repeat of the MUC1 mucin. In addition, the influence of primary amino acid sequence on acceptor substrate activity was evaluated using several peptides that contained single or double amino acid substitutions (relative to the native human MUC1 sequence). These included substitutions in the residues that were glycosylated and substitutions in the surrounding primary amino acid sequence. This study demonstrates that primary amino acid sequence, length, and relative position of the residue to be glycosylated dramatically affect the ability of peptides to serve as acceptor substrates for UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferase.
...
PMID:Influence of acceptor substrate primary amino acid sequence on the activity of human UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferase. Studies with the MUC1 tandem repeat. 820 12


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>

---