Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P51532 (transcriptional activator)
 6,546 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The expression of the genes encoding the hormones glucagon, insulin, somatostatin, and pancreatic polypeptide in the endocrine islets of the pancreas is regulated in a cell-specific manner, defining four distinct cellular phenotypes (A-, B-, D-, and F-cells, respectively). Binding of nuclear proteins to cognate DNA sequences within cis-acting regulatory elements mediates the transcriptional events that result in the cell-specific activation or repression of gene expression. In a parallel study, we describe the functional properties of the SMS-UE, a pancreatic islet D-cell specific enhancer element that regulates the expression of the somatostatin gene and contains two interdependent domains, A and B. In the studies described herein, we have characterized the nuclear proteins that recognize the SMS-UE. Domain A of the SMS-UE is a DNA enhancer sequence that is identical to that bound by the ubiquitously distributed CCAAT box-binding protein alpha-CBF, a transcription factor that regulates the expression of the human chorionic gonadotrophin alpha-subunit gene. The B-domain, on the other hand, binds an islet cell-specific protein with characteristics similar to those of Isl-1, a transcriptional activator protein that binds to the E2 enhancer of the rat insulin-1 gene. In addition, the SMS-UE binds transcription factor CREB but not CREM, the close homolog of CREB, on a site adjacent to, or overlapping, the 3' end of domain B. We show that the carboxyl-terminal bZIP domain of CREB binds to the cAMP response element of the somatostatin gene but is not sufficient for binding to the SMS-UE, and we present evidence suggesting that CREB.SMS-UE binding requires stabilization by a region of the protein located within the transactivation domain.
 ...
PMID:Somatostatin gene upstream enhancer element activated by a protein complex consisting of CREB, Isl-1-like, and alpha-CBF-like transcription factors. 135 92

The LuxR protein is a transcriptional activator involved in regulation of the genes required for bioluminescence (lux) in the marine bacterium Vibrio fischeri. Transcription of the two divergently oriented lux operons (luxR and luxICDABEG) is activated by LuxR in the presence of a diffusible inducer (autoinducer). Transcription of the luxR gene is subject to both positive and negative autoregulation as well as activation by the cAMP-catabolite gene activator protein complex (cAMP-CAP). Transcription of luxR was studied using both luminescence in vivo as a reporter and primer extension analysis of mRNA synthesized in vivo. Mutation of the lux CAP-binding site resulted in a reduction in luminescence from the reporter and the complete loss of luxR positive autoregulation. Positive autoregulation was restored if luxR was provided in trans, demonstrating that LuxR and autoinducer activate luxR transcription in the absence of cAMP-CAP. By means of primer extension analysis, three sites of initiation of luxR transcription were demonstrated; initiation at two of these sites required cAMP-CAP. The quantity of all three transcripts was increased in the presence of LuxR and autoinducer when a plasmid with a wild-type CAP-binding site was used. Initiation at the cAMP-CAP-dependent sites was not observed from a plasmid with a mutated CAP-binding site in the presence or absence of autoinducer even with luxR supplied in trans. Instead, with luxR supplied in trans, initiation at the cAMP-CAP-independent initiation site was specifically stimulated by LuxR and autoinducer. Thus, in the course of positive autoregulation, the LuxR protein activates transcription from two luxR promoters by a cAMP-CAP-dependent mechanism and a third promoter by a cAMP-CAP-independent mechanism.
 ...
PMID:Positive autoregulation of the Vibrio fischeri luxR gene. LuxR and autoinducer activate cAMP-catabolite gene activator protein complex-independent and -dependent luxR transcription. 137 36

A cAMP response element (CRE) plays an important role in the cAMP-mediated gene regulation. Several factors that recognize a CRE have been characterized, and it has been shown that they need either covalent modification by protein kinase A or a cofactor such as the adenovirus Ela to function as an activator. In this study we show that the substance P precursor gene expression is regulated by protein kinase A and identify the CRE sequence in its promoter region. We find that a novel factor and ATF2 bind to the region containing the CRE of the substance P precursor gene. The sequence analysis indicates that the novel protein, designated CELF, has a significant homology to C/EBP gene family proteins in the carboxyl-terminal part containing the basic region and the leucine zipper motif. Ubiquitous expression of CELF suggests that this factor is utilized by various genes. Cell-free transcription analyses indicate that CELF is a constitutive transcriptional activator without apparent phosphorylation by protein kinase A. These results demonstrate that multiple factors are responsible for transcriptional control of the substance P precursor gene through the CRE region.
 ...
PMID:Molecular characterization of transcription factors that bind to the cAMP responsive region of the substance P precursor gene. cDNA cloning of a novel C/EBP-related factor. 171 59

The products of a minimum of 15 genes are required for the synthesis of an active formate-hydrogenlyase (FHL) system in Escherichia coli. All are co-ordinately regulated in response to variations in the oxygen and nitrate concentration and the pH of the culture medium. Formate is obligately required for transcriptional activation of these genes. Analysis of the transcription of one of these genes, hycB linked to the lacZ reporter gene, revealed that oxygen and nitrate repression of transcription could be relieved completely, or partially in the case of nitrate, either by the addition of formate to the medium or by increasing the copy number of the gene encoding the transcriptional activator (fhlA) of this regulon. These studies uncovered a further level of regulation in which the transcription of hycB was reduced in cells grown on glucose. This effect was most clearly seen in aerobically grown cells when formate was added externally. Addition of cAMP overcame this glucose repression, which could be shown to be mediated by the cAMP receptor protein. These results would be consistent with the transport of formate being regulated by catabolite repression. Moreover, the repression of transcription through high pH also could be partially overcome by addition of increasing concentrations of formate to the medium, again being consistent with regulation at the level of formate import and export. Taken together, all these observations indicate that it is the intracellular level of formate that determines the transcription of the genes of the formate regulon by FhlA. This represents a novel positive feedback mechanism in which the activator of a regulon induces its own synthesis in response to increases in the concentration of the catabolic substrate, and this in turn is governed by the relative affinities of FhlA and the three formate dehydrogenase isoenzymes for formate.
 ...
PMID:Mechanism of regulation of the formate-hydrogenlyase pathway by oxygen, nitrate, and pH: definition of the formate regulon. 177 67

Transcription of the human vasoactive intestinal peptide (VIP) gene is regulated by both cyclic AMP and phorbol esters. A 17-nucleotide enhancer element within the human VIP gene mediates transcriptional activation by both phorbol esters and forskolin. Mutations of this element decrease responses to both agents, suggesting that the trans-acting proteins that mediate both modes of transcriptional regulation have similar DNA-binding characteristics. The response of the VIP enhancer element to forskolin, but not to 12-O-tetradecanoylphorbol-13-acetate, was attenuated by treatment with a recombinant inhibitor of the cAMP-dependent protein kinase, suggesting that the cAMP-dependent protein kinase and protein kinase C second messenger pathways that converge on this single enhancer element are distinct. The transcriptional activator cAMP-responsive element-binding (CREB) proteins and the c-fos.c-Jun complex interact with the VIP enhancer. The dual second messenger responses of the VIP gene may result from the interaction of this second messenger enhancer with different transcriptional activator proteins.
 ...
PMID:Cyclic AMP- and phorbol ester-induced transcriptional activation are mediated by the same enhancer element in the human vasoactive intestinal peptide gene. 184 91

IL-1, like other agents that have been shown a capacity to induce protein kinase C, is a potent transcriptional activator of the metalloproteinase, stromelysin, in synovial and other fibroblasts. cAMP has been shown to inhibit stromelysin transcription in fibroblasts of nonsynovial origin, and is regarded as an important second messenger for IL-1. In addition to stimulating metalloproteinase transcription, IL-1 also induces PGE2 production in synoviocytes. We determined that rIL-1 alpha led to the time-dependent accumulation of intracellular cAMP in serum-starved rheumatoid synovial fibroblasts, and that the effect was blocked by indomethacin. The cAMP agonists forskolin, 3-isobutyl-1-methylxanthine, and PGE2 suppressed the IL-1 induction of stromelysin; conversely, indomethacin superinduced IL-1-elicited stromelysin mRNA. These results were recapitulated on the transcriptional level in cells transfected with the rat transin/stromelysin promoter in a reporter (CAT) construct. 2',5'-Dideoxyadenosine, an inhibitor of adenylate cyclase, also augmented the IL-1 induction of stromeylsin mRNA, as did H-8, a specific inhibitor of the cAMP-dependent protein kinase A. Staurosporine and H-7, inhibitors of protein kinase C, blocked the IL-1 induction of stromelysin mRNA. We conclude that IL-1 appears to stimulate at least two transduction pathways in synovial fibroblasts from patients with rheumatoid arthritis, and that these have antagonistic effects on the regulation of stromelysin transcription.
 ...
PMID:IL-1 regulation of transin/stromelysin transcription in rheumatoid synovial fibroblasts appears to involve two antagonistic transduction pathways, an inhibitory, prostaglandin-dependent pathway mediated by cAMP, and a stimulatory, protein kinase C-dependent pathway. 217 73

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)
 ...
PMID:Control of the lux regulon of Vibrio fischeri. 218 99

T cell-specific expression of the human T cell receptor alpha (TCR-alpha) gene is regulated by the interaction of variable region promoter elements with a transcriptional enhancer that is located 4.5 kb 3' of the TCR-alpha constant region (C alpha) gene segment. The minimal TCR-alpha enhancer is composed of two nuclear protein binding sites, T alpha 1 and T alpha 2, that are both required for the T cell-specific activity of the enhancer. The T alpha 1 binding site contains a consensus cAMP response element (CRE), and binds a set of ubiquitous nuclear proteins. The T alpha 2 binding site does not contain known transcriptional enhancer motifs. However, it binds at least two nuclear protein complexes, one of which is T cell specific. We now report that although the T alpha 2 nuclear protein binding site displays transcriptional activator activity in the context of the TCR-alpha enhancer, this site alone can function as a potent, T cell-specific transcriptional repressor when positioned either upstream, or downstream of several heterologous promoter and enhancer elements. These results demonstrate that a single nuclear protein binding site can function as a T cell-specific transcriptional activator or repressor element, depending upon the context in which it is located.
 ...
PMID:The T alpha 2 nuclear protein binding site from the human T cell receptor alpha enhancer functions as both a T cell-specific transcriptional activator and repressor. 223 Jun 52

Can a transcriptional activator known to bend DNA be functionally replaced by a sequence-directed bend in Escherichia coli? To investigate this question, a partially truncated promoter was used, deleted of its -35 region and of its CRP binding site, leaving only two Pribnow boxes as functional elements. Synthetic and naturally occurring curved DNA sequences introduced upstream from these elements could restore transcription at either one of the two natural starts. Some of these hybrid promoters turned out to be more efficient than the CRP activated wild-type gal promoter in vivo. Control experiments performed with very similar sequences devoid of any curvature produced weak promoters only. Minimal changes in the location of the centre of curvature or perturbation in the amount of curvature strongly affected the level of expression. No significant stimulation of transcription could be detected in vitro. Furthermore, both gal P1 and P2 starts could be activated in vivo but also in vitro via a properly positioned CRP binding site. This partial analogy suggests that bending induced by the cAMP-CRP complex upon binding to its site may be biologically relevant to the mechanism of transcriptional activation.
 ...
PMID:Synthetic curved DNA sequences can act as transcriptional activators in Escherichia coli. 251 22

An operon mediating biogenesis of digalactoside-binding pilus-adhesin of serotype F13 in uropathogenic Escherichia coli includes the regulatory gene papB. The papB gene product was found to act as transcriptional activator of an operon which includes the papB gene and several pap cistrons encoding the proteins of the pilus polymer. Studies of how pap gene expression was affected by increasing amounts of PapB protein in the cells showed that high levels did not stimulate transcription but caused repression. Results from in vitro studies demonstrated that the PapB protein was a sequence-specific DNA-binding protein. Binding studies using gel mobility shift assays and DNase I protection (footprinting) showed that PapB protein binds to three separate sites. A sequence greater than 200 bp upstream of the promoter, and directly adjacent to a binding site for the cAMP receptor protein-cAMP complex, appeared as a preferential PapB binding site. A second site was localized to sequences overlapping the -10 region of the promoter and a third binding site was found within the coding sequence of the papB gene itself. The data suggest that the PapB protein has a dual function as activator/repressor of pilus-adhesin transcription and that its autoregulatory mode of action involves differential binding to separate sites.
 ...
PMID:Autoregulation and multiple DNA interactions by a transcriptional regulatory protein in E. coli pili biogenesis. 256 58


1 2 3 4 5 6 7 8 9 10 Next >>