Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P51532 (
transcriptional activator
)
6,546
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a
transcriptional activator
protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl)
homoserine
lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Control of the lux regulon of Vibrio fischeri. 218 99
In recent years it has become clear that the production of N-acyl
homoserine
lactones (N-AHLs) is widespread in Gram-negative bacteria. These molecules act as diffusible chemical communication signals (bacterial pheromones) which regulate diverse physiological processes including bioluminescence, antibiotic production, plasmid conjugal transfer and synthesis of exoenzyme virulence factors in plant and animal pathogens. The paradigm for N-AHL production is in the bioluminescence (lux) phenotype of Photobacterium fischeri (formerly classified as Vibrio fischeri) where the signalling molecule N-(3-oxohexanoyl)-L-
homoserine
lactone (OHHL) is synthesized by the action of the LuxI protein. OHHL is thought to bind to the LuxR protein, allowing it to act as a positive
transcriptional activator
in an autoinduction process that physiologically couples cell density (and growth phase) to the expression of the bioluminescence genes. Based on the growing information on LuxI and LuxR homologues in other N-AHL-producing bacterial species such as Erwinia carotovora, Pseudomonas aeruginosa, Yersinia enterocolitica, Agrobacterium tumefaciens and Rhizobium leguminosarum, it seems that analogues of the P. fischeri lux autoinducer sensing system are widely distributed in bacteria. The general physiological function of these simple chemical signalling systems appears to be the modulation of discrete and diverse metabolic processes in concert with cell density. In an evolutionary sense, the elaboration and action of these bacterial pheromones can be viewed as an example of multicellularity in prokaryotic populations.
...
PMID:The bacterial 'enigma': cracking the code of cell-cell communication. 747 57
In Pseudomonas aeruginosa PAO1, expression of elastase is dependent upon an interaction between the positive
transcriptional activator
LasR and the auto-inducer molecule N-(3-oxododecanoyl)-L-
homoserine
lactone (OdDHL), the synthesis of which is directed by LasI. Previously we have shown that in PAN067, an elastase-negative mutant of PAO1, elastase production can be restored to some extent by addition of exogenous N-(3-oxohexanoyl)-L-
homoserine
lactone (OHHL). Here we report that PAN067 is also defective in the production of alkaline protease, haemolysin, cyanide, pyocyanin and autoinducer(s). As neither addition of exogenous OdDHL nor introduction of lasR restored PAN067 to the parental phenotype, we sought to complement PAN067 with PAO1 DNA. From a cosmid library, a 2 kb DNA fragment was identified which re-established production of autoinducer(s) and exoproducts in PAN067. From the nucleotide sequence of this fragment, two genes termed rhIR and rhII were identified. RhII is responsible for autoinducer synthesis and shares 31% homology with LasI; RhIR has been previously identified in P. aeruginosa strain DSM2659 as a regulator of rhamnolipid biosynthesis and shares 28% identity with LasR. These data provide clear evidence that multiple families of quorum-sensing modulons interactively regulate gene expression in P. aeruginosa.
...
PMID:Multiple homologues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. 749 82
Pseudomonas aeruginosa produces a spectrum of exoproducts many of which have been implicated in the pathogenesis of human infection. Expression of some of these factors requires cell-cell communication involving the interaction of a small diffusible molecule, an "autoinducer," with a positive
transcriptional activator
. In P. aeruginosa PAO1, LasI directs the synthesis of the autoinducer N-(3-oxododecanoyl)-L-
homoserine
lactone (OdDHL), which activates the positive
transcriptional activator
, LasR. Recently, we have discovered a second signaling molecule-based modulon in PAO1, termed vsm, which contains the genes vsmR and vsmI. Using HPLC, mass spectrometry, and NMR spectroscopy we now establish that in Escherichia coli, VsmI directs the synthesis of N-butanoyl-L-
homoserine
lactone (BHL) and N-hexanoyl-L-
homoserine
lactone (HHL). These compounds are present in the spent culture supernatants of P. aeruginosa in a molar ratio of approximately 15:1 and their structures were unequivocally confirmed by chemical synthesis. Addition of either BHL or HHL to PAN067, a pleiotropic P. aeruginosa mutant unable to synthesize either of these autoinducers, restored elastase, chitinase, and cyanide production. In E. coli carrying a vsmR/vsmI'::lux transcriptional fusion, BHL and HHL activated VsmR to a similar extent. Analogues of these N-acyl-L-
homoserine
lactones in which the N-acyl side chain has been extended and/or oxidized at the C-3 position exhibit substantially lower activity (e.g., OdDHL) or no activity (e.g., dDHL) in this lux reporter assay. These data indicate that multiple families of quorum sensing modulons interactively regulate gene expression in P. aeruginosa.
...
PMID:Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa. 756 46
In Vibrio fischeri, the autoinducer N-3-oxohexanoyl-L-
homoserine
lactone (AI-1) governs the cell density-dependent induction of the luminescence operon via the LuxR
transcriptional activator
. The synthesis of AI-1 from bacterial metabolic intermediates is dependent on luxI. Recently, we found a second V. fischeri autoinducer molecule, N-octanoyl-L-
homoserine
lactone (AI-2), that in E. coli also activates the luminescence operon via LuxR. A locus independent of luxI was identified as being required for AI-2 synthesis. This 2.7-kb ain (autoinducer) locus was characterized by transposon insertion mutagenesis, deletion and complementation analysis, and DNA sequencing. A single 1,185-bp gene, ainS, was found to be the sole exogenous gene necessary for the synthesis of AI-2 in Escherichia coli. In addition, a V. fischeri ainS mutant produced AI-1 but not AI-2, confirming that in its native species ainS is specific for the synthesis of AI-2. ainS is predicted to encode a 45,580-Da protein which exhibits no similarity to LuxI or to any of the LuxI homologs responsible for the synthesis of N-acyl-L-
homoserine
lactones in a variety of other bacteria. The existence of two different and unrelated autoinducer synthesis genes suggests the occurrence of convergent evolution in the synthesis of
homoserine
lactone signaling molecules. The C-terminal half of AinS shows homology to a putative protein in Vibrio harveyi, LuxM, which is required for the synthesis of a V. harveyi bioluminescence autoinducer. Together, AinS and LuxM define a new family of autoinducer synthesis proteins. Furthermore, the predicted product of another gene, ainR, encoded immediately downstream of ainS, shows homology to LuxN, which is similarly encoded downstream of luxM in V. harveyi and proposed to have sensor/regulator functions in the bioluminescence response to the V. harveyi auto inducer. This similarity presents the possibility that AI-2, besides interacting with LuxR, also interacts with AinR under presently unknown conditions.
...
PMID:AinS and a new family of autoinducer synthesis proteins. 759 89
N-Acylhomoserine lactone (acyl-HSL)-mediated gene expression, also called autoinduction, is conserved among diverse gram-negative bacteria. In the paradigm Vibrio fischeri system, bioluminescence is autoinducible, and the lux operon requires the
transcriptional activator
LuxR and the acyl-HSL autoinducer for expression. The production of the acyl-HSL signal molecule is conferred by the luxI gene, and luxR encodes the transcriptional regulator. We show here that Erwinia stewartii, the etiological agent of Stewart's wilt of sweet corn, synthesizes an acyl-HSL. Mass spectral analysis identified the signal molecule as N-(-3-oxohexanoyl)-L-
homoserine
lactone, which is identical to the V. fischeri autoinducer. We have cloned and sequenced the gene that confers acyl-HSL biosynthesis, called esaI, and the linked gene, esaR, that encodes a gene regulator. The two genes are convergently transcribed and show an unusual overlap of 31 bp at their 3' ends. Sequence analysis indicates that EsaI and EsaR are homologs of LuxI and LuxR, respectively. EsaR can repress its own expression but seems not to regulate the expression of esaI. The untranslated 5' region of esaR contains an inverted repeat with similarity to the lux box-like elements located in the promoter regions of other gene systems regulated by autoinduction. However, unlike the other systems, in which the inverted repeats are located upstream of the -35 promoter elements, the esaR-associated repeat overlaps a putative -10 element. We mutagenized the esaI gene in E. stewartii by gene replacement. The mutant no longer produced detectable levels of the acyl-HSL signal, leading to a concomitant loss of extracellular polysaccharide capsule production and pathogenicity. Both phenotypes were restored by complementation with esal or by exogenous addition of the acyl-HSL.
...
PMID:Capsular polysaccharide biosynthesis and pathogenicity in Erwinia stewartii require induction by an N-acylhomoserine lactone autoinducer. 766 77
In Vibrio fischeri, the synthesis of N-3-oxohexanoyl-L-
homoserine
lactone, the autoinducer for population density-responsive induction of the luminescence operon (the lux operon, luxICDABEG), is dependent on the autoinducer synthase gene luxI. Gene replacement mutants of V. fischeri defective in luxI, which had been expected to produce no autoinducer, nonetheless exhibited lux operon transcriptional activation. Mutants released into the medium a compound that, like N-3-oxohexanoyl-L-
homoserine
lactone, activated expression of the lux system in a dose-dependent manner and was both extractable with ethyl acetate and labile to base. The luxI-independent compound, also like N-3-oxohexanoyl-L-
homoserine
lactone, was produced by V. fischeri cells in a regulated, population density-responsive manner and required the
transcriptional activator
LuxR for activity in the lux system. The luxI-independent compound was identified as N-octanoyl-L-
homoserine
lactone by coelution with the synthetic compound in reversed-phase high-pressure liquid chromatography, by derivatization treatment with 2,4-dinitrophenylhydrazine, by mass spectrometry, and by nuclear magnetic resonance spectroscopy. A locus, ain, necessary and sufficient for Escherichia coli to synthesize N-octanoyl-L-
homoserine
lactone was cloned from the V. fischeri genome and found to be distinct from luxI by restriction mapping and Southern hybridization. N-Octanoyl-L-
homoserine
lactone and ain constitute a second, novel autoinduction system for population density-responsive signalling and regulation of lux gene expression, and possibly other genes, in V. fischeri. A third V. fischeri autoinducer, N-hexanoyl-L-
homoserine
lactone, dependent on luxI for its synthesis, was also identified. The presence of multiple chemically and genetically distinct but cross-acting autoinduction systems in V. fischeri indicates unexpected complexity for autoinduction as a regulatory mechanism in this bacterium.
...
PMID:Multiple N-acyl-L-homoserine lactone autoinducers of luminescence in the marine symbiotic bacterium Vibrio fischeri. 800 80
Conjugal transfer of the nopaline-type Agrobacterium Ti plasmid pTiC58 is regulated by a
transcriptional activator
, TraR, and a diffusible signal molecule, conjugation factor (CF). CF is a member of a family of substituted
homoserine
lactones (HSLs) that act as coinducers for regulating gene expression in diverse Gram-negative bacteria by a mechanism called autoinduction. In Vibrio fischeri HSL production is conferred by the luxI gene. Homologues of this gene are responsible for HSL production by other Gram-negative bacteria. A gene that we call traI, conferring production of material with CF activity, was localized to a 1-kb region at the upstream end of tra3 of pTiC58. Spectroscopy showed that the activity was authentic CF. Sequence analysis showed that traI could encode a protein of 211 amino acids, TraI, that is related to the proteins responsible for HSL production by other bacteria. A second, partial open reading frame immediately downstream of traI could encode a protein related to TrbB of plasmid RP4, which is required for conjugal transfer. Transcription of traI and of the downstream tra3 genes requires TraR and CF and initiates from the traI promoter. The results show that traI is responsible for CF production, that it is the first gene of the tra3 operon, and that expression of this operon is regulated by autoinduction.
...
PMID:TraI, a LuxI homologue, is responsible for production of conjugation factor, the Ti plasmid N-acylhomoserine lactone autoinducer. 819 12
The Sym plasmid pRL1JI encodes functions for the formation of nitrogen-fixing pea root nodules by Rhizobium leguminosarum. Some of the nodulation genes are involved in recognition of chemical signals produced by the plant root, and others are required for production of chemical signals recognized by the plant. pRL1JI also contains a regulatory gene, rhiR, that is homologous to luxR, the
transcriptional activator
of luminescence genes in Vibrio fischeri. LuxR requires a signal compound, an autoinducer, for its activity. We have identified an R. leguminosarum autoinducer that, together with RhiR, is required to activate both the rhizosphere-expressed rhiABC operon and a growth-inhibiting function encoded by pRL1JI. This intercellular signal is an N-acylated
homoserine
lactone structurally related to the V. fischeri and other autoinducers. These findings indicate a new level of intercellular communication in root nodule formation.
...
PMID:Cell-to-cell signaling in the symbiotic nitrogen-fixing bacterium Rhizobium leguminosarum: autoinduction of a stationary phase and rhizosphere-expressed genes. 855 Apr 55
Conjugation of Agrobacterium tumefaciens wide-host-range octopine-type Ti plasmids is regulated by the LuxR-type
transcriptional activator
TraR in conjunction with an acylated
homoserine
lactone designated AAI. Expression of traR in octopine-type Ti plasmids is stimulated by OccR in response to octopine, an opine released from crown gall tumours, and is also positively autoregulated by TraR and AAI. Genetic and physical mapping of these promoters indicates that the OccR-activated promoter lies 14.5 kb upstream of traR, while the TraR-activated promoter lies 6 kb upstream. The upstream portion of the 14.5 kb operon contains seven previously characterized genes that direct the uptake and catabolism of octopine. The TraR-activated promoter lies just downstream from the octopine catabolic genes, and transcribes six genes in addition to traR, including five genes (ophABCDE) that show strong homology to oligo-peptide permeases of Salmonella typhimurium and Bacillus subtilis. Several TraR-regulated promoters overlap with 18 bp inverted repeats called tra boxes. In contrast, the traR autoregulatory promoter is not associated with a consensus tra box.
...
PMID:Localization of OccR-activated and TraR-activated promoters that express two ABC-type permeases and the traR gene of Ti plasmid pTiR10. 880 72
1
2
3
4
5
6
7
8
Next >>