Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P43026 (lipopolysaccharide)
 62,215 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A monoclonal antibody (PmPG5-3) specific for the O-acetylated peptidoglycan of Proteus mirabilis 19 was produced by an NS-1 myeloma cell line and purified from ascites fluid by a combination of ammonium sulfate precipitation and affinity chromatography. The monoclonal antibody (an immunoglobulin M) was characterized by a competition enzyme-linked immunosorbent assay to be equally specific for both insoluble and soluble O-acetylated peptidoglycan but weakly recognized chemically de-O-acetylated P. mirabilis peptidoglycan, the non-O-acetylated peptidoglycans from Escherichia coli and Bacillus subtilis, and the peptidoglycan monosaccharide precursors N-acetylglucosamine and N-acetylmuramic acid dipeptide. The monoclonal antibody did not react with D-alanine or lipopolysaccharide isolated from P. mirabilis. Based on this evidence, the binding epitope on the P. mirabilis peptidoglycan is predicted to be linear and to comprise the glycan backbone, including both the N- and O-acetyl moieties. Monoclonal antibody PmPG5-3 was used to localize the O acetylation of the P. mirabilis peptidoglycan by immunoelectron microscopy. Murein sacculi of P. mirabilis were heavily and randomly labelled with the immunogold, whereas very little labelling and no labelling were observed on the sacculi isolated from de-O-acetylated P. mirabilis and E. coli, respectively. Based on the apparent pattern of immunogold labelling, a physiological role for peptidoglycan O acetylation in P. mirabilis is proposed.
 ...
PMID:Production and characterization of a monoclonal antibody to the O-acetylated peptidoglycan of Proteus mirabilis. 162 61

Conjugate vaccines were prepared in an attempt to protect pigs against swine pleuropneumonia induced by Actinobacillus pleuropneumoniae (SPAP). Two subunit conjugates were prepared by coupling the A. pleuropneumoniae 4074 serotype 1 capsular polysaccharide (CP) to the hemolysin protein (HP) and the lipopolysaccharide (LPS) to the HP. Adipic acid dihydrazide was used as a spacer to facilitate the conjugation in a carbodiimide-mediated reaction. The CP and the LPS were found to be covalently coupled to the HP in the conjugates as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and detergent gel chromatography analyses. Following a booster vaccination, pigs exhibited significantly high (P less than 0.05) immunoglobulin G antibodies against CP, LPS, and HP. The anti-CP and anti-LPS immunoglobulin G antibodies were found to function as opsonins in the phagocytosis of A. pleuropneumoniae by polymorphonuclear leukocytes, whereas antibodies to the HP neutralized the cytotoxic effect of the HP on polymorphonuclear leukocytes. No killing of A. pleuropneumoniae was observed when the effects of the antibodies were tested in the presence of complement. Thus, polysaccharide-protein A. pleuropneumoniae conjugates elicit significant antibody responses against each component of each conjugate, which could be instrumental in protecting swine against SPAP.
 ...
PMID:Preparation, characterization, and immunogenicity of conjugate vaccines directed against Actinobacillus pleuropneumoniae virulence determinants. 163 71

Mechanisms of resistance to pefloxacin were investigated in four isogenic Pseudomonas aeruginosa strains: S (parent isolate; MIC, 2 micrograms/ml), PT1 and PT2 (posttherapy isolates obtained in animals; MICs, 32 and 128 micrograms/ml, respectively), and PT2-r (posttherapy isolate obtained after six in vitro subpassages of PT2; MIC, 32 micrograms/ml). [2-3H]adenine incorporation (indirect evidence of DNA gyrase activity) in EDTA-permeabilized cells was less affected by pefloxacin in PT2 and PT2-r (50% inhibitory concentration, 0.27 and 0.26 microgram/ml, respectively) than it was in S and PT1 (50% inhibitory concentration, 0.04 and 0.05 microgram/ml, respectively). Reduced [14C]pefloxacin labeling of intact cells in strains PT1 and PT2 correlated with more susceptibility to EDTA and the presence of more calcium (P less than 0.05) and phosphorus in the outer membrane fractions. Outer membrane protein analysis showed reduced expression of protein D2 (47 kDa) in strains PT1 and PT2. Other proteins were apparently similar in all strains. The addition of calcium chloride (2 mM) to the sodium dodecyl sulfate-solubilized samples of outer membrane proteins, before heating and Western blotting, probed with monoclonal antibody anti-OmpF showed electrophoretic mobility changes of OmpF in strains PT1 and PT2 which were not seen in strain S. Calcium-induced changes were reversed with ethyleneglycoltetraacetate. Decreased [14C]pefloxacin labeling was further correlated with an altered lipopolysaccharide pattern and increased 3-deoxy-D-mannooctulosonic acid concentration (P less than 0.01). These findings suggested that resistance to pefloxacin is associated with altered DNA gyrase in strain PT2-r, with altered permeability in PT1, and with both mechanisms in PT2. The decreased expression of protein D2 and the higher calcium and lipopolysaccharide contents of the outer membrane could be responsible for the permeability deficiency in P. aeruginosa.
 ...
PMID:Resistance to pefloxacin in Pseudomonas aeruginosa. 164 9

Activated macrophages participate in inflammation by eliminating foreign cells, promoting wound healing, and modulating the immune response. A murine monoclonal antibody, designated anti-rat macrophage activator (RMA), was raised against alveolar macrophages (AM) activated with interferon-gamma (IFN-gamma) and phorbol myristate acetate (PMA). The RMA antigen is expressed by resident macrophages but not by other cells. Binding to AM by anti-RMA is not competitively inhibited by the murine monoclonal antibodies MRC OX-41, OX-42, and OX-43. Surface membrane expression of RMA antigens is upregulated by lipopolysaccharide, PMA, and tumor necrosis factor-alpha but not by IFN-gamma. Stimulation of AM with anti-RMA yields distinct ultrastructural alterations, as well as de novo protein and DNA synthesis. Immunoprecipitation of [35S]methionine metabolically labeled AM yields a 120 kD protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) that is not altered by chemical reduction. We conclude that the RMA antigen is macrophage specific and that binding of anti-RMA to AM promotes functional activities in a subset of these cells.
 ...
PMID:Anti-RMA: a murine monoclonal antibody that activates rat macrophages. I. Distribution and characterization of the RMA antigen. 168 87

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.
 ...
PMID:Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells. 169 Aug 49

The serological relationships among 32 isolates of Edwardsiella ictaluri obtained from fish were studied. The strains were extremely homogeneous in protein and lipopolysaccharide preparations as observed by sodium-dodecyl-sulfate polyacrylamide gel electrophoresis. Only minor variations were observed in the structural O-side chain subunits in three isolates; however, such variation did not preclude antigenic recognition by two E. ictaluri antisera in either microagglutination or Western blot immunoassays. The antigenic homogeneity of E. ictaluri was further demonstrated by microagglutination assays with both formalin-killed and heat inactivated cellular antigens. The minimal degree of antigenic variability observed suggested that most isolates of E. ictaluri compose a single antigenic serotype.
 ...
PMID:Serological investigation of the fish pathogen Edwardsiella ictaluri, cause of enteric septicemia of catfish. 169 95

O-antigen units are nonuniformly distributed among lipid A-core molecules in lipopolysaccharide (LPS) from gram-negative bacteria, as revealed by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the actual distribution patterns are complex, multimodal, and strain specific. Although the basic biochemical steps involved in synthesis and polymerization of O-antigen monomers and their subsequent attachment to lipid A-core are known, the mechanism by which specific multimodal distribution patterns are attained in mature LPS has not been previously considered theoretically or experimentally. We have developed probability equations which completely describe O-antigen distribution among lipid A-core molecules in terms of the probability of finding a nascent polymer (O antigen linked to carrier lipid) of length k (Tk) and the probability that a nascent polymer of length k will be extended to k + 1 by polymerase (pk) or transferred to lipid A-core by ligase (qk). These equations were used to show that multimodal distribution patterns in mature LPS cannot be produced if all pk are equal to p and all qk are equal to q, conditions which indicate a lack of selectivity of polymerase and ligase, respectively, for nascent O-antigen chain lengths. A completely stochastic model (pk = p, qk = q) of O-antigen polymerization and transfer to lipid A-core was also inconsistent with observed effects of mutations which resulted in partial inhibition of O-antigen monomer synthesis, lipid A-core synthesis, or ligase activity. The simplest explanation compatible with experimental observations is that polymerase or ligase, or perhaps both, have specificity for certain O-antigen chain lengths during biosynthesis of LPS. Our mathematical model indicates selectively probably was associated with the polymerase reaction. Although one may argue for a multimodal distribution pattern based on a kinetic mechanism i.e., varying reaction parameters in space or in time during cell growth, such a model requires complex sensory and regulatory mechanisms to explain the mutant data and mechanisms for sequestering specific components of LPS biosynthesis to explain the distribution pattern in normal cells. We favor the simple alternative of enzyme specificity and present generalized equations which should be useful in analysis of other analogous biochemical systems.
 ...
PMID:Mechanism of O-antigen distribution in lipopolysaccharide. 169 78

A panel of monoclonal antibodies (MAbs) to seven Brucella outer membrane proteins were characterized. These antibodies were obtained by immunizing mice with sodium dodecyl sulfate-insoluble (SDS-I) fractions, cell walls, or whole bacterial cells of Brucella abortus or B. melitensis. Enzyme-linked immunosorbent assays were used to screen the hybridoma supernatants and to determine their binding at the surface of rough and smooth B. abortus and B. melitensis cells. The outer membrane proteins (OMPs) recognized by these antibodies were the proteins with molecular masses of 25 to 27 kDa and 36 to 38 kDa (porin) (major proteins) and the proteins with molecular masses of 10, 16.5, 19, 31 to 34, and 89 kDa (minor proteins). Surface exposure of these OMPs was visualized by electron microscopy by using the MAbs and immunogold labeling. Binding of the MAbs on whole rough bacterial cells indicates that the 10-, 16.5-, 19-, 25- to 27-, 31- to 34-, 36- to 38-, and 89-kDa OMPs are exposed at the cell surface. However, enzyme-linked immunosorbent assay results indicate a much better binding of the anti-OMP MAbs on rough strains than on the corresponding smooth strains except for the anti-19-kDa MAb. Immunoelectron microscopy showed that on smooth B. abortus cells only the 89- and 31- to 34-kDa OMPs were not accessible to the MAbs tested. Binding of the anti-31- to 34-kDa MAb at the cell surface was observed for the rough B. abortus cells and for the rough and smooth B. melitensis cells. These results indicate the importance of steric hindrance due to the presence of the long lipopolysaccharide O side chains in the accessibility of OMPs on smooth Brucella strains and should be considered when undertaking vaccine development.
 ...
PMID:Identification of seven surface-exposed Brucella outer membrane proteins by use of monoclonal antibodies: immunogold labeling for electron microscopy and enzyme-linked immunosorbent assay. 170 17

A silver staining method used routinely for detecting bacterial lipopolysaccharide (LPS) in sodium dodecyl sulfate-polyacrylamide gels (C. Tsai and E. Frasch, Anal. Biochem. 119:115-119, 1982) appeared to be inappropriate for visualizing certain LPS preparations. It did not stain S-form fractions of polyagglutinable Pseudomonas aeruginosa LPS or several partly deacylated (alkali-treated) S-form LPS after sodium dodecyl sulfate-polyacrylamide gel electrophoresis. However, these LPS preparations could be detected by anti-LPS sera after electroblotting onto nitrocellulose, thereby confirming their integrity and presence in the polyacrylamide gel. This is because LPS fractions containing a low number of fatty acids are washed out of the gel during the initial fixing step (40% ethanol-4% acetic acid, overnight). By omitting this fixing step, which was originally developed for detecting proteins, and by increasing the LPS oxidation time (from 5 to 20 min), we restored the ability to detect LPS fractions that otherwise would not be stained. These modifications did not affect the detection of other S- and R-form LPSs. Thus, differences in the number of fatty acids present in polyagglutinable P. aeruginosa LPS may result in a selective loss of fatty acid-deficient S-form LPS in these apparent R-form LPS preparations. This modified procedure provides a fast, simple, and sensitive way to analyze LPS in polyacrylamide gels despite the number of acyl groups present.
 ...
PMID:Modification of the silver staining technique to detect lipopolysaccharide in polyacrylamide gels. 170 12

The lipopolysaccharide (LPS) molecule is an important virulence determinant in Klebsiella pneumoniae. Studies on the serotype O1 LPS were initiated to determine the basis for antigenic heterogeneity previously observed in the O1 side chain polysaccharides and to resolve apparent ambiguities in the reported polysaccharide structure. Detailed chemical analysis, involving methylation and 1H- and 13C-nuclear magnetic resonance studies, demonstrated that the O-side chain polysaccharides of serotype O1 LPS contained a mixture of two structurally distinct D-galactan polymers. The repeating unit structures of these two polymers were identified as [----3)-beta-D-Galf-(1----3)-alpha-D-Galp-(1----] (D-galactan I) and [----3)-alpha-D-Galp-(1----3)-beta-D-Galp-(1----] (D-Galactan II). D-Galactan I polysaccharides were heterogeneous in size and were detected throughout the sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) profile of O1 LPS. In contrast, D-galactan II was confined to the higher-molecular-weight region. The structures of the two D-galactans were not influenced by simultaneous synthesis of a capsular K antigen. Apparently, neither of the D-galactans constitutes a common antigen widespread in Klebsiella spp. as determined by immunochemical analysis. Examination of the LPSs in mutants indicated that expression of D-galactan I can occur independently of D-galactan II. Transconjugants of Escherichia coli K-12 strains carrying the his region of K. pneumoniae were constructed by chromosome mobilization with RP4::mini-Mu. In these transconjugants, the O antigen encoded by the his-linked rfb locus was determined to be D-galactan I, suggesting that genes involved in the expression of D-galactan II are not closely linked to the rfb cluster.
 ...
PMID:Expression of two structurally distinct D-galactan O antigens in the lipopolysaccharide of Klebsiella pneumoniae serotype O1. 170 83


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>