Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P43026 (lipopolysaccharide)
 62,215 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.
 ...
PMID:Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells. 169 Aug 49

The immunoglobulin kappa light chain enhancer, kappa B, is an important cis-acting transcriptional element. kappa B binds a number of proteins including the members of the ubiquitous NF-kappa B family of transcription factors. Agarose beads coupled to a double-stranded oligonucleotide containing the kappa B motif were used to isolate a 65-kDa predominantly nuclear phosphoprotein. Southwestern blot analysis demonstrated that this phosphoprotein can bind the kappa B element directly and specifically. This kappa B-associated protein was phosphorylated in vivo and in vitro by a nuclear serine/threonine kinase(s) which, in a number of different cell lines, appeared to be stimulated in response to interleukin-1 alpha and lipopolysaccharide treatment. In the B cell lines 70Z/3 and CH12 LX2B, and the T cell line EL-4 6.1 C10 the activity of the kappa B-associated kinase(s) correlated with the binding activity of nuclear NF-kappa B displayed in a gel shift assay. In vitro, the 65-kDa protein was phosphorylated in the absence of exogenously added kinase. The 65-kDa phosphoprotein and the kinase activity remained associated following sequential anion-exchange and hydrophobic interaction chromatography. These results suggest that the kappa B-associated phosphoprotein is either autophosphorylated or is phosphorylated by a closely associated kinase(s). Stimulation of a nuclear protein kinase which is closely associated with a sequence-specific DNA may reflect a novel mechanism by which growth factors regulate gene expression.
 ...
PMID:A serine/threonine kinase activity is closely associated with a 65-kDa phosphoprotein specifically recognized by the kappa B enhancer element. 182 60

Treatment of splenic B lymphocytes and certain B-lineage cell lines with the mitogen lipopolysaccharide (LPS) and the lymphokine interleukin-4 (IL-4) induces expression of germ line immunoglobulin C epsilon transcripts and class switching to the C epsilon gene. We show that LPS-plus-IL-4 induction of germ line epsilon transcripts (termed I epsilon transcripts) occurs at the transcriptional level in an Abelson murine leukemia virus-transformed pre-B-cell line. A 1.1-kb region of DNA surrounding the I epsilon promoter endows inducible transcription to a heterologous reporter gene stably transfected into these cells; such inducible expression depends on combined treatment with LPS and IL-4. Analyses of constructs transiently introduced into a B-cell lymphoma line demonstrated that LPS-plus-IL-4-inducible expression can be conferred by a 179-bp segment of DNA spanning the I epsilon transcriptional initiation site. Mutational analyses demonstrated that this expression depended on DNA sequences within a conserved region directly upstream from the I epsilon transcriptional initiation region. One nuclear protein that is constitutively expressed in normal B cells binds to the downstream end of the conserved sequence; its binding specificity correlates with the functional effect of several mutations. Two additional proteins, which are induced by IL-4 treatment of splenic B cells, bind to the transcription initiation sites of I epsilon. These proteins are indistinguishable in binding assays from proteins previously shown to bind an enhancer region of the class II major histocompatibility complex gene A alpha.
 ...
PMID:Identification of a conserved lipopolysaccharide-plus-interleukin-4-responsive element located at the promoter of germ line epsilon transcripts. 192 63

NF-kappa B is a nuclear protein, found only in cells that transcribe immunoglobulin light chain genes, that interacts with a defined site in the kappa immunoglobulin enhancer. This protein can be induced in pre-B cells by stimulation with bacterial lipopolysaccharide (LPS). The induction involves a posttranslational activation, and the combined action of LPS and cycloheximide causes a superinduction. An active phorbol ester also induces this factor, and with kinetics more rapid than those for LPS stimulation. Phorbol-ester-mediated induction of NF-kappa B was observed in a T cell line (Jurkat) and a nonlymphoid cell line (HeLa), and is therefore not restricted to B-lymphoid cells. We interpret these results to indicate that factors that control transcription of specific genes in specific cells may be activated by posttranslational modification of precursor factors present more widely.
 ...
PMID:Inducibility of kappa immunoglobulin enhancer-binding protein Nf-kappa B by a posttranslational mechanism. 309 80

To detect nuclear proteins that might be involved in induction of cellular mitogenesis, we examined the effect of various mitogens on early changes in synthesis of nuclear proteins in murine B lymphocytes. Using two-dimensional gel electrophoresis, we found that activation of B cells by mitogens (anti-immunoglobulin antibody, lipopolysaccharide, phorbol 12-myristate 13-acetate (PMA)/A23187) was associated with a rapid and prominent (5-20-fold) increase in the synthesis of a 40-kDa/pI 5.0 nuclear protein, here termed numatrin. Numatrin was found to be absent from the cytosol (soluble fraction) of resting as well as activated B cells and was markedly resistant to DNase/RNase digestion and 2 N NaCl extraction, indicating that this protein is tightly bound to the nuclear matrix. Kinetic studies showed that the increase in synthesis of numatrin was detected 60-120 min following mitogen activation, reached a peak at 16 h, and declined to almost control level by 48 h, correlating with the peak of cellular DNA synthesis. The increase in synthesis of numatrin in normal B cells was found to be associated exclusively with cellular commitment for mitogenesis because activation of B cells by stimuli such as B cell stimulating factor 1, PMA alone, and calcium ionophore A23187, which do not stimulate an increase in DNA synthesis, also failed to induce an increase in the synthesis of numatrin. Inhibition of anti-Ig-induced proliferation (by PMA pretreatment) was associated with a 63% inhibition in the synthesis of numatrin. Addition of 8-mercaptoguanosine to these PMA-treated cells was associated with restoration of the increase in synthesis of numatrin, concomitant with induction of proliferation. Elevated synthesis of numatrin was also detected in the malignant B lymphoma cells: Raji, BAL-17, and WEHI-231. Taken collectively, these results suggest that numatrin, a tightly bound nuclear matrix protein, is a growth-regulated protein which might have an important role in regulation of cellular mitogenesis in normal and malignant B lymphocytes.
 ...
PMID:"Numatrin," a nuclear matrix protein associated with induction of proliferation in B lymphocytes. 330 55

A lupus-like disease characterized by a severe immune complex glomerulonephritis and IgG autoantibody production was induced in (C57BL/6 X DBA/2)F1 mice by injection of parental DBA/2 lymphoid cells. The ensuing graft-vs-host (GVH) reaction resulted in a 10- and a 100-fold increase in serum IgG antibody levels to denatured DNA and total histones, respectively, compared with that in F1----F1 control mice. The level of anti-DNA antibodies peaked 2 wk after injection of DBA/2 cells and preceded peak anti-histone levels by approximately 2 wk. Anti-histone antibodies were generated predominantly to histones H1, H2A, and H2B, a profile different from that observed in NZB/NZW and MRL-lpr/lpr mice. The marked increase in IgG antinuclear antibodies did not correlate with increases in total IgG serum levels and was not associated with comparable increases in antibodies to transferrin, hemoglobin, fibrinogen, or thyroglobulin. Selective autoantibody production was also observed in vitro, wherein GVH spleen cells produced high levels of IgG antibodies to total histones and denatured DNA but not to these non-nuclear protein antigens. In contrast, spleen cells stimulated in vitro with lipopolysaccharide produced equivalent amounts of antibodies to all antigens tested. Our results are in agreement with those of other investigators and collectively suggest that IgG autoantibodies in GVH disease, and possibly in spontaneous lupus-like disease, are not secondary to a generalized B cell activation, but may be selectively generated in response to self antigens with unique configurational properties.
 ...
PMID:Autoimmunization in murine graft-vs-host disease. I. Selective production of antibodies to histones and DNA. 387 58

The effects of cytokines, lipopolysaccharide (LPS), 8-bromoadenosine 3',5'-cyclic monophosphate (8-BrcAMP), and pyrrolidine dithiocarbamate (PDTC), an inhibitor of nuclear factor kappa B (NF-kappa B) activation, on inducible nitric oxide synthase (iNOS) expression were studied in the medullary thick ascending limb of Henle's loop cell line ST-1. LPS + interferon-gamma (IF-gamma) promoted a time-dependent increase in nitrite (a NO metabolite) and iNOS mRNA and the appearance of NF-kappa B p50 and p65 in nuclear protein extracts. Actinomycin D but not cycloheximide prevented the LPS + IF-gamma induction of iNOS mRNA and NO synthesis, indicating that iNOS transcriptional activation by LPS + IF-gamma does not require newly synthesized proteins. PDTC inhibited the LPS + IF-gamma induction of NO, iNOS mRNA, and the appearance of NF-kappa B in nuclear protein extracts, suggesting that NF-kappa B mobilization and trans-activation of the iNOS gene mediates this induction. In contrast to other cell types, cycloheximide did not alter iNOS mRNA stability, and 8-BrcAMP did not alter basal or LPS+IF-gamma induced NO production in ST-1 cells.
 ...
PMID:Role of NF-kappa B in the regulation of inducible nitric oxide synthase in an MTAL cell line. 750 39

The cytokines interleukin-1 beta (IL-1 beta) and tumor necrosis factor alpha (TNF-alpha) are released by mononuclear phagocytes in vitro after stimulation with mycobacteria and are considered to mediate pathophysiologic events, including granuloma formation and systemic symptoms. We demonstrated that the Mycobacterium tuberculosis cell wall component lipoarabinomannan (LAM) is a very potent inducer of IL-1 beta gene expression in human monocytes and investigated the mechanism of this effect. We localized the LAM-, lipopolysaccharide (LPS)-, and TNF-alpha-inducible promoter activity to a -131/+15 (positions -131 to +15) DNA fragment of the IL-1 beta gene by deletion analysis and chloramphenicol acetyltransferase assay. Within this DNA fragment, there were two novel 9-bp motifs (-90/-82 and -40/-32) with high homology to the nuclear factor-IL6 (NF-IL6) binding site. Site-directed mutagenesis demonstrated that the two NF-IL-6 motifs could be independently activated by LAM, LPS, or TNF-alpha and that they acted in an orientation-independent manner. DNA mobility shift assay revealed specific binding of nuclear protein(s) from LAM-, LPS-, or TNF-alpha-stimulated THP-1 cells to the NF-IL6 motifs. We conclude that the two NF-IL6 sites mediate induction of IL-1 beta in response to the stimuli LAM, LPS, and TNF-alpha.
 ...
PMID:Regulation of the interleukin-1 beta (IL-1 beta) gene by mycobacterial components and lipopolysaccharide is mediated by two nuclear factor-IL6 motifs. 768 3

The rate of germ-line RNA transcription correlates with the rate of immunoglobulin heavy chain isotype switching. A promoter element for the transcription of RNA from the germ-line mouse immunoglobulin epsilon heavy chain constant region gene is induced by interleukin(IL)-4 and lipopolysaccharide, and is bound at its transcription initiation sites by an IL-4-inducible nuclear protein, NF-BRE. To examine the function of the binding site for this IL-4-inducible complex, substitution mutations were introduced in the promoter. These binding site mutations increased promoter activity and decreased binding of NF-BRE. To investigate the paradox of an IL-4-inducible protein binding to a repressor site in an IL-4-inducible promoter, we determined that the non-histone chromosomal protein HMG-I(Y) binds at the transcription initiation sites of the germ-line epsilon promoter. Assays with antisera against HMG-I(Y) revealed monomeric HMG-I(Y) in nuclear extracts. Cotransfection of an expression construct directing the synthesis of anti-sense HMG-I(Y) RNA also increased promoter activity, consistent with a repressor function of HMG-I(Y). Thus, the data are most consistent with a model in which HMG-I(Y) participates in repression of promoter activity. The effects of IL-4 may include derepression at this site.
 ...
PMID:The non-histone chromosomal protein HMG-I(Y) contributes to repression of the immunoglobulin heavy chain germ-line epsilon RNA promoter. 770 11

Intercellular adhesion molecule-1 (ICAM-1) is greatly up-regulated on endothelial cells at sites of inflammation and is involved in leukocyte attachment and extravasation. Previously, we had shown that the ICAM-1 gene expression in human umbilical vein endothelial cells (HUVECs) was transcriptionally regulated by tumor necrosis factor-alpha (TNF-alpha) (Wertheimer, S. J., Myers, C. L., Wallace, R. W., and Parks, T. P. (1992) J. Biol. Chem. 267, 12030-12035). In the present investigation, TNF-alpha-induced transcription was found to be initiated exclusively at two sites, 40 and 41 base pairs upstream of the translation start site. Deletion analysis of the 5' regulatory region of the ICAM-1 gene revealed a 92-base pair sequence which was both necessary and sufficient to confer TNF-alpha responsiveness to a linked luciferase reporter gene in transient transfection assays. This TNF-alpha-responsive region contained a variant NF-kappa B site at -187 to -178, which when mutated, completely abolished ICAM-1 promoter activation by TNF-alpha, interleukin-1 beta, and lipopolysaccharide. Two inducible nuclear protein complexes bound to the ICAM-1 kappa B and were identified as the NF-kappa B p65 homodimer and p65/p50 heterodimer. Overexpression of p65, but not p50, transactivated the ICAM-1 promoter in a kappa B site-dependent manner in HUVECs. In addition, p65-mediated transactivation was suppressed by co-expression of p50. Our results suggest that cytokine activation of the ICAM-1 promoter in HUVECs may critically depend on p65 homodimers binding to a variant kappa B site.
 ...
PMID:Transcriptional regulation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in human endothelial cells. Essential roles of a variant NF-kappa B site and p65 homodimers. 782 33


1 2 3 4 5 6 7 8 9 Next >>