Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P30536 (PBS)
9,886 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Anterior pituitaries from primiparous lactating C3H/He mice cultured in the medium containing 0.1% dimethyl sulfoxide (DMSO) for 48 hours and pituitaries from lactating mice given subcutaneous injections of 0.05 ml DMSO twice daily for two days and once on the morning of the third day were used in the studies of the in vitro and the in vivo effects of DMSO, respectively. Phosphate buffer saline was used in the control. Synthesis and release of growth hormone and prolactin were estimated by the incorporation of [14C]leucine into each hormone during three hours' incubation of the pituitaries pre-exposed to DMSO or PBS. The values in the medium represented released hormone and sum of the values in the medium and the pituitary represented the synthesized hormone. DMSO stimulated synthesis of GH and synthesis and release of prolactin in vitro. Meanwhile, in the vivo study, synthesis of GH and prolactin were lower in the DMSO-injected mice than in the control. The results suggest that the effects of DMSO on the pituitary secretion of GH and prolactin are adverse in vitro and in vivo. In vivo exposure of pituitary to DMSO resulted in the suppression of lactation.
...
PMID:The in vitro and in vivo effects of dimethyl sulfoxide on the pituitary secretion of growth hormone and prolactin in mice. 619 45

Twenty-five permanent teeth, including eight carious ones whose pulp cavities had been exposed, were used for this research 3-5 weeks after extraction. Phosphate-buffered saline (PBS, at pH 7.2) was employed to extract ABO blood group substance from tooth powder. ABO grouping was performed on blood-stained compresses from the extraction wound (as controls), tooth fragment, tooth powder, and cotton fibers immersed in PBS extract by absorption-elution (AE) technique and on the PBS extracts by the two-dimensional absorption-inhibition (2-D AI) technique. It was found that blood grouping in PBS extracts by 2-D AI yielded reliable results: no false positive results, and a high rate of correct grouping, (24/25), while blood grouping on other dental materials, such as tooth fragments, tooth powders, immersed fibers, by AE gave an unacceptable rate of false positive/negative results.
...
PMID:ABO blood grouping on dental tissue. 835 10

These studies were designed to determine whether continuous i.v. infusion of increasing dosages of porcine relaxin during late pregnancy in beef heifers would influence circulating blood concentrations of relaxin, progesterone and oxytocin, and time of onset of parturition. Beef heifers were bred by artificial insemination and, on Day 277, fitted with indwelling jugular cannulas for hormone infusion and blood sampling from Day 277 to Day 286. Intravenous infusion of purified porcine relaxin (pRLX, 3000 U mg-1) was started in heifers (n = 8) at increasing dosages (200 U h-1 on Days 277 and 278, 300 U h-1 on Days 279 and 280, 500 U h-1 on Day 281, 600 U h-1 on Day 282, and 700 U h-1 on Days 283-286). Phosphate-buffered saline (PBS, 10 ml h-1) was infused during these same times to control animals (n = 6). Relaxin treatment steadily increased the circulating plasma concentration of immunoreactive relaxin to more than 120 ng ml-1 compared with less than 0.5 ng ml-1 in PBS-treated controls. Relaxin infusion in increasing dosages over the treatment time was associated with a significant decrease (P < 0.01) in plasma progesterone concentration compared with the PBS controls. The rate of change in progesterone levels between pRLX and PBS groups differed (P < 0.05) at 300 U h-1, 600 U h-1 and 700 Uh-1 dosage intervals, respectively. Plasma levels of oxytocin at 4 h intervals remained similar (P > 0.05) during the pretreatment period and throughout continuous infusion of pRLX and PBS. Mean concentrations of oxytocin in PBS control heifers peaked at 0.95 pgml-1 during the corresponding infusion of 700 Uh-1 pRLX, which peaked at 0.77 pgml-1. Although continuous i.v. infusion of relaxin resulted in a decrease in circulating blood levels of progesterone, it did not significantly reduce the interval between the beginning of pRLX treatment and parturition compared with the PBS-infused control heifers. These results indicate that continuous i.v. infusion of high levels of porcine relaxin resulted in a decrease in progesterone secretion in late pregnant beef heifers.
...
PMID:Continuous infusion of relaxin on periparturient progesterone, oxytocin and relaxin plasma concentrations and time of parturition in beef heifers. 923 Dec 43

Using a group of structurally related cytofectins, the effects of different vehicle constituents and mixing techniques on the physical properties and biological activity of lipoplexes were systematically examined. Physical properties were examined using a combination of dye accessibility assays, centrifugation, gel electrophoresis and dynamic light scattering. Biological activity was examined using in vitro transfection. Lipoplexes were formulated using two injection vehicles commonly used for in vivo delivery (PBS pH 7.2 and 0.9% saline), and a sodium phosphate vehicle previously shown to enhance the biological activity of naked pDNA and lipoplex formulations. Phosphate was found to be unique in its effect on lipoplexes. Specifically, the accessible pDNA in lipoplexes formulated with cytofectins containing a gamma-amine substitution in the headgroup was dependent on alkyl side chain length and sodium phosphate concentration, but the same effects were not observed when using cytofectins containing a beta-OH headgroup substitution. The physicochemical features of the phosphate anion, which give rise to this effect in gamma-amine cytofectins, were deduced using a series of phosphate analogs. The effects of the formulation vehicle on transfection were found to be cell type-dependent; however, of the formulation variables examined, the liposome/pDNA mixing method had the greatest effect on transgene expression in vitro. Thus, though predictive physical structure relationships involving the vehicle and cytofectin components of the lipoplex were uncovered, they did not extrapolate to trends in biological activity.
...
PMID:Trends in lipoplex physical properties dependent on cationic lipid structure, vehicle and complexation procedure do not correlate with biological activity. 1126 56

Gastrodia elata Bl. (GE) is a traditional Chinese herb that is commonly used in Chinese communities to treat convulsive disorders such as epilepsy. The purpose of the present study was to determine the anticonvulsive and free radical activities of GE in rats. In vitro studies were conducted by using brain tissue from 6 male Sprague-Dawley (SD) rats treated with 120 microg/ml of kainic acid (KA), with or without the addition of various concentrations of GE. In vivo studies were conducted in a total of 30 male SD rats divided into 5 groups of 6 rats which were treated as follows: 1) the normal group received an intraperitoneal injection (i.p.) of PBS (Phosphate buffer saline, 1 ml/kg); 2) the control group received KA (12 mg/kg) i.p.; 3) the GE 1.0 group received oral administration of GE 1.0 g/kg 30 min prior to KA administration; 4) the GE 0.5 group received oral administration of GE 0.5 g/kg 30 min prior to KA administration; 5) the PH group received oral administration of phenytoin 20 mg/kg 30 min prior to KA administration. Seizures were verified by behavioral observations, electroencephalograph (EEG) and electromyography (EMG). Lipid peroxide levels in the rat brain, luminol chemiluminescence (CL) and lucigenin-CL in the peripheral blood were measured simultaneously after behavioral observations. The results indicate that GE administration significantly reduced KA-induced lipid peroxide levels in vitro. Oral administration of GE 1.0 g/kg and phenytoin 20 mg/kg significantly reduced counts of wet dog shakes (WDS), paw tremor (PT) and facial myoclonia (FM) in KA-treated rats. In addition, oral administration of GE 1.0 g/kg significantly delayed the onset of WDS, from 30 min in the control group to 46 min in the 0.5 g/kg group, and 63 min in the GE 1.0 g/kg group. A significantly reduced level of lipid peroxides in the rat brain was found in the GE 1.0 g/kg, 0.5 g/kg, and phenytoin 20 mg/kg groups. The GE 1.0 g/kg group showed significant reduction of luminol-CL and lucigenin-CL counts in the peripheral blood compared to the control group. The results of the present study demonstrate that GE has anticonvulsive and free radical scavenging activities. Further studies are needed to determine the clinical effectiveness of GE as an anticonvulsant in humans.
...
PMID:Anticonvulsive and free radical scavenging activities of Gastrodia elata Bl. in kainic acid-treated rats. 1152 75

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.
...
PMID:The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis. 1220 64

The objective of this study was to investigate the molecular mechanisms of neurobiological processes involved in the degeneration of the central nervous system. The bovine spongiform encephalopathy (BSE) was used as experimental model system for investigation of transmissible spongiform encephalopathy (TSE). The experimental strategy was to evaluate the possibility for protection of bovine PrP(C) transgenic mice against a bovine PrP(Sc) infection by DNA vaccination using the complete or partial cDNA sequences of the bovine prion protein. Three recombinant plasmids pCR3.1-EX-PrP-BSE-C20 (C20), pCR3.1-EX-PrP-BSE-90-235-C4 (C4), and pCR3.1-EX-PrP-BSE-106-131-C14 (C14) were constructed. These mammalian expression vectors harbor complete (C20) or partial (C4 and C14) cDNA sequences of the Bos taurus PrP(C) (BTPrP(C)) encoding for amino acid residues 1-264 (C20), 90-235 (C4), and 106-131 (C14) of the BTPrP(C). Transgenic mice harboring and expressing BTPrP(C) were generated using the donor strain C57/CBA, receptor strain Swiss mouse, and recombinant plasmid MoPrPXho-boPrP. Crossing of positive transgenic mice to bovine PrP and negative to murine PrP with 129/OLA (murine PrP-/-) and C57BL6x129/OLA (murine PrP+/-) mice was carried out to amplify the colony of transgenic mice termed bovine PrP(C) transgenic Swiss mice (BTPrP-TgM). The capabilities of C20, C4, and C14 to express the corresponding cDNA sequence of BTPrP(C) in vitro and in vivo were confirmed prior to DNA vaccination of the BTPrP-TgM using NIH 3T3 cells and BALB/c mice, respectively. In order to prove the capability of the constructed expression vectors to protect BTPrP-TgM in vivo against a BSE infection 80 female BTPrP-TgM were vaccinated intramuscularly and subcutaneously with DNA of the plasmids C20, C4, C14, and parental vector pCR3.1 (100 microg DNA corresponding to about 26-30 pmol DNA/animal and application) in four groups (each consists of 20 animals). DNA vaccination was followed by three additional boosters. The vaccinated animals (15 animals of each group) were challenged twice per oral with homogenates of brain material obtained from BSE cattle containing the infectious PrP(Sc) (100 microl/animal which corresponds to 15 mg of a 15% brain homogenate). The first and second challenge experiments were performed 76-83 and 181 days post DNA vaccination, respectively. A part of the vaccinated animals (3-5 animals of each group) that served as internal negative control were mock infected using the brain homogenate of healthy cattle or Phosphate saline buffer (PBS). A variety of symptoms and clinical pictures were observed during the monitoring of DNA vaccinated animals. However, the observed diseases seem to be similar in all experimental animal groups. After an observation period of 14 months post the second challenge experiment the remaining animals (some animals died or were sacrificed when moribund during the study) were sacrificed after expiration of the experimental schedule. The right hemisphere of the brain and a half of the spleen tissue of the individual animals were used for detection of PrP(Sc) by Western blot analysis. The misfolded bovine PrP(Sc) was not detected in the brain or spleen tissues of those animals that were vaccinated with DNA of C20, which was able to express the complete bovine PrP(C) protein in vitro and in vivo. In contrast, the bovine PrP(Sc) was detected in the brain or spleen tissues of animals that were DNA vaccinated with DNA of the parental vector pCR3.1, with DNA of C4, or with DNA of C14. The results of these studies underline that the constructed expression vector C20 possesses the protective capacity to inhibit the formation of misfolded bovine PrP(Sc) in BTPrP-TgM under the conditions used. A delay of occurrence of TSE-specific symptoms in the majority of the vaccinated animals seems to be due to the prolonged incubation time of BSE infection.
...
PMID:Testing the possibility to protect bovine PrPC transgenic Swiss mice against bovine PrPSc infection by DNA vaccination using recombinant plasmid vectors harboring and expressing the complete or partial cDNA sequences of bovine PrPC. 1574 83

There has recently been a great deal of effort put towards the development of bioMEMS-based electrochemical biosensors for use in implantable devices. Currently, the primary issue limiting the lifespan of implantable sensors is protein and cell adhesion (biofouling) to the sensor surface, which impedes the sensor's access to analyte. To better understand this problem, it would be useful to have an understanding of how silicon-based microdevices interact with proteins in a physiological environment. To help answer this question, we investigated the interactions of proteins with microtextured silicon wafers. Bulk micromachining techniques were used to create micro-textures that varied between 5 and 80 microns in size nd spacing. We used n-type and p-type silicon wafers with a <100> crystal orientation. Shapes such as rectangles, circles, and triangles were fabricated that were recessed into the silicon substrate. The features were estimated to be between 3 and 8 microns in depth. After the features were created, the wafers were coated with a layer of silicon dioxide. Once fabrication was complete, the wafers were incubated in vitro ith fluorescently tagged Albumin (500 microg/ml in Phosphate-Buffered Saline, PBS) for 5 minutes. The wafers were then rinsed with PBS solution and viewed using an epifluorescence microscope. Albumin adsorbed selectively onto the micropatterned wafers. Depending on the type of wafer we found that albumin adsorbed selectively onto either the bulk surface, the sidewalls, or the bottom of the etched feature.
...
PMID:Selective protein adsorption on micro-textured P-type and N-type silicon wafers. 1585 Jan 2

The immune system of neonatal chicks is functionally immature during the first week of life. Researchers have previously demonstrated that the avian humoral response can be increased with probiotics. Although the humoral response provides the chick with an effective mechanism to combat pathogens, sufficient antibody titers are not attained until 7 to 10 d postinfection. However, the innate immune system (i.e., heterophils) can respond much more quickly to pathogens. The objective of this study was to determine whether probiotic bacteria can also upregulate heterophil function. Heterophils were isolated from the peripheral blood of neonatal chickens by using a discontinuous density gradient. Oxidative burst and degranulation are bactericidal mechanisms used by heterophils to kill pathogens and were used in this study as indicators of heterophil function. We found that each of the 10 "generally recognized as safe" probiotic isolates (designated G1 to G11) tested in vitro were capable of increasing (P < 0.05) heterophil oxidative burst and degranulation when compared with unstimulated controls. Bacillus subtilis (G3), Lactococcus lactis lactis (G6), and Lactobacillus acidophilus (G8) isolates were determined to elicit the greatest heterophil response in vitro and were subsequently fed to chicks. Phosphate-buffered saline or 1 of these 3 probiotic isolates (approximately 2.5 x 10(8) cfu/chick; 50 chicks/treatment) resuspended in PBS was administered by oral gavage on the day of hatch. Heterophils were isolated from chicks from each of these 4 treatment groups 24 h posttreatment. Significant increases in heterophil degranulation and oxidative burst were observed with the G3-, G6-, and G8-treated chicks when compared with heterophils isolated from birds with no probiotic treatment. These data suggest that probiotic bacteria can significantly improve heterophil oxidative burst and degranulation in broilers. To our knowledge, this is the first study demonstrating a relationship between probiotics and avian heterophil function.
...
PMID:Upregulation of oxidative burst and degranulation in chicken heterophils stimulated with probiotic bacteria. 1703 21

We investigated whether compensatory reinnervation in the corticospinal tract (CST) and the corticorubral tract (CRT) is enhanced by the administration of bone marrow stromal cells (BMSCs) after experimental stroke. Adult male Wistar rats were subjected to permanent right middle cerebral artery occlusion (MCAo). Phosphate-buffered saline (PBS, control, n=7) or 3x10(6) BMSCs in PBS (n=8) were injected into a tail vein at 1 day postischemia. The CST of the left sensorimotor cortices was labeled with DiI 2 days prior to MCAo. Functional recovery was measured. Rats were sacrificed at 28 days after MCAo. The brain and spinal cord were removed and processed for vibratome sections for laser-scanning confocal analysis and paraffin sections for immunohistochemistry. Normal rats (n=4) exhibited a predominantly unilateral pattern of innervation of CST and CRT axons. After stroke, bilateral innervation occurred through axonal sprouting of the uninjured CRT and CST. Administration of BMSCs significantly increased the axonal restructuring on the de-afferented red nucleus and the denervated spinal motoneurons (p<0.05). BMSC treatment also significantly increased synaptic proteins in the denervated motoneurons. These results were highly correlated with improved functional outcome after stroke (r>0.81, p<0.01). We conclude that the transplantation of BMSCs enhances axonal sprouting and rewiring into the denervated spinal cord which may facilitate functional recovery after focal cerebral ischemia.
...
PMID:Axonal sprouting into the denervated spinal cord and synaptic and postsynaptic protein expression in the spinal cord after transplantation of bone marrow stromal cell in stroke rats. 1736 81


1 2 3 4 5 6 Next >>