UNIPROT:P19793 - FACTA Search

Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Target Concepts:

Query: UNIPROT:P19793 (retinoid X receptor alpha)
391 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have isolated a human peroxisomal proliferator activated receptor (hPPAR) from a human liver cDNA library. Based on sequence analysis, we have determined that this cDNA encodes the human PPAR alpha. When assayed in a reconstituted hPPAR responsive transcription system in mammalian CV-1 cells, this receptor was shown to be transcriptionally activated by hypolipidemic agents like clofibric acid, and ETYA (5,8,11,14-eicosatetraynoic acid; a synthetic arachidonic acid homolog). When analyzed in CV-1 cells, the rat PPAR alpha was similarly transcriptionally regulated. However, when assayed in a human liver cell line (HepG2) we noticed that ETYA was a more efficient activator of hPPAR alpha than rPPAR alpha. Thus, factors other than the receptor are important in determining the cellular responsiveness to this class of compounds. Interestingly, WY-14,643, another peroxisome proliferator, was a much more potent activator of rPPAR alpha than human PPAR alpha when assayed in both cell lines. This may explain in part why certain fibrates are potent hepatocarcinogens in rodents. Northern analysis indicates that hPPAR alpha and rPPAR alpha are well expressed in heart, kidney and liver. We further demonstrate that hPPAR alpha and human retinoid X receptor alpha synergistically interact to bind and transactivate through a peroxisomal proliferator response element. Thus in a similar cell and promoter context the rat and human PPARs show a differential response to certain activators. Cumulatively these data suggest that differential ligand responsiveness does not provide a complete explanation for the different biological effects exhibited by hypolipidemic drugs when administered to humans and rats.
...
PMID:Human and rat peroxisome proliferator activated receptors (PPARs) demonstrate similar tissue distribution but different responsiveness to PPAR activators. 798 Nov 25

The hepatitis B virus enhancer 1 contains a retinoic acid responsive element (RARE). We have previously demonstrated that retinoid X receptor alpha (RXR alpha) transactivates enhancer 1 by binding to the RARE. The present study has revealed that a heterodimeric complex composed of RXR alpha and peroxisome proliferator-activated receptor (PPAR) interacts with the hepatitis B virus RARE. Transient transfection studies, in conjunction with in vitro DNA binding data, support the hypothesis that the RXR alpha-PPAR heterodimer transactivates enhancer 1.
...
PMID:Retinoid X receptor alpha transactivates the hepatitis B virus enhancer 1 element by forming a heterodimeric complex with the peroxisome proliferator-activated receptor. 798 54

All-trans retinoic acid (tRA) inhibits growth of estrogen receptor-positive (ER+) breast cancer cells in vitro, and a variety of retinoids inhibit development of breast cancer in animal models. 9-cis retinoic acid (9-cis RA) is a naturally occurring high affinity ligand for the retinoid X receptors, as well as the retinoic acid receptors (RARs). Whether 9-cis RA has a different spectrum of biological activity from tRA, which only binds RARs with high affinity, is largely unknown. We studied the effects of 9-cis RA on growth and gene expression in ER+ and ER- human breast cancer cells. 9-cis RA inhibited the growth in monolayer culture of several ER+, but not ER-, cell lines in a dose-dependent manner. Growth inhibition and morphological changes by 9-cis RA were similar to those of tRA, suggesting that the ability to bind both RAR and retinoid X receptors did not significantly augment growth inhibition or confer sensitivity to tRA-resistant lines. MCF-7 cells exposed to 9-cis RA showed a dose-dependent accumulation in G1. Northern analyses showed that RAR-alpha and RAR-beta were not significantly regulated, while RAR-gamma was up-regulated and retinoid X receptor alpha was down-regulated by 9-cis RA. Since interactions between tRA and ER-dependent transcription have recently been reported, we investigated whether these retinoids regulate expression of ER itself or estrogen-responsive genes. Both 9-cis RA and tRA induce down-regulation of ER mRNA and protein in MCF-7 cells. 9-cis RA down-regulates expression of the estrogen-responsive genes PR and pS2 in MCF-7 cells as reported previously for tRA. In several ER-positive subclones, we found that the degree of ER expression and regulation, but not always estrogen-sensitivity, correlates with the growth-inhibitory effects of 9-cis RA. Further, in an ER-, retinoid-unresponsive breast cancer cell line, induced ER expression confers responsiveness to retinoid growth inhibition. These data, combined with reports of additive growth inhibition of tRA and tamoxifen in vitro, suggest that 9-cis RA might augment the ability of tamoxifen to inhibit growth of ER+ breast cancer cells in vivo.
...
PMID:9-Cis retinoic acid inhibits growth of breast cancer cells and down-regulates estrogen receptor RNA and protein. 798 55

P450 4A6 is highly induced by peroxisome proliferators in vivo. Gene transfer experiments indicate that this induction can be mediated by the mouse peroxisome proliferator-activated receptor alpha (PPAR alpha) and that it is dependent on upstream enhancer elements in the CYP4A6 gene. However, as has been seen for other peroxisome proliferator response elements (PPREs), PPAR alpha does not bind directly to a previously characterized PPRE of the CYP4A6 gene in the absence of additional proteins such as the retinoid X receptor alpha (RXR alpha). When PPAR alpha and RXR alpha are coexpressed, the overall transcription of the CYP4A6 reporter is increased, and a synergistic response to both retinoids and peroxisome proliferators is evident that is dependent on the presence of both receptors. In addition, a cryptic response element is unmasked in constructs lacking the upstream enhancers. DNase I protection assays indicate that when present together, but not singly, PPAR alpha and RXR alpha bind to a site located within 29 base pairs upstream of the CYP4A6 transcription start site. This region contains a sequence similar to that found in the apolipoprotein CIII gene that has been shown to bind RXR alpha and the orphan nuclear receptor, ARP-1. The corresponding sequence in the CYP4A6 gene also binds ARP-1. A similar sequence found in the promoter region of the rat CYP4A1 gene does not, however, bind either PPAR alpha/RXR alpha or ARP-1. Transfection of increasing amounts of the ARP-1 expression vector blocks the PPAR alpha/RXR alpha-mediated induction of transcription from the CYP4A6 promoter. Mutations that prevent the binding of either PPAR alpha/RXR alpha or ARP-1 to a double-stranded oligonucleotide corresponding to the proximal enhancer eliminate the peroxisome proliferator-induced transcriptional response observed for the promoter construct in the presence of PPAR alpha/RXR alpha, but these mutations do not eliminate the response seen when the upstream enhancers are present. These results indicate that the PPREs of the CYP4A6 gene are recognized by multiple members of the nuclear receptor family that are likely to contribute to the regulation of CYP4A6 expression in both an agonistic (RXR alpha) and an antagonistic (ARP-1) manner.
...
PMID:Interaction of the peroxisome proliferator-activated receptor alpha with the retinoid X receptor alpha unmasks a cryptic peroxisome proliferator response element that overlaps an ARP-1-binding site in the CYP4A6 promoter. 802 69

In order to study the structural details of ligand protein interactions of the human retinoid X receptor alpha (hRXR alpha), the DEF and EF domains of the receptor were expressed as glutathione S-transferase (GST) fusion proteins in Escherichia coli. The fusion proteins were expressed at high levels and were affinity-purified by chromatography over glutathione-agarose. The DEF and EF domains were cleaved from the fusion proteins by digestion with thrombin. Retinoic acid binding was quantitated using two different methods. The apparent dissociation constant (Kd) and the stoichiometry of 9-cis-retinoic acid binding were performed by monitoring quenching of protein fluorescence. To directly compare the binding affinity of the E. coli-derived truncated hRXR alpha with full-length hRXR alpha expressed in transiently transfected COS cells, Scatchard analyses of [3H]9-cis-retinoic acid binding assays were performed. Both methods of analysis indicate that while the cleaved DEF peptide bound 9-cis-retinoic acid tightly, the cleaved EF peptide exhibited variable binding activity between preparations. By fluorimetric analysis, the Kd of the cleaved DEF peptide was estimated to be 3 +/- 0.5 nM with a stoichiometry of 1:1.1 +/- 0.1. By Scatchard analysis, the Kd values for [3H]9-cis-retinoic acid to the GST-hRXR alpha (DEF) peptide and the cleaved DEF peptide were estimated to be 1.8 nM and 5.6 nM, respectively. The estimated molecular mass from high speed sedimentation equilibrium experiments was 36 +/- 2 kDa for the apo-DEF peptide alone and 38 +/- 3 kDa for the holo-DEF peptide complexed with 9-cis-retinoic acid. This suggests that the recombinant ligand binding domain was predominantly in the monomer form. However, dimers of the cleaved DEF peptides were detected in chemical cross-linking experiments both in the presence and absence of 9-cis-retinoic acid. Since the purified E. coli-derived truncated hRXR alpha DEF peptide appears to fully retain its ligand binding activity, it should provide a useful model system for further structural analysis of ligand-protein interactions.
...
PMID:Characterization of the ligand binding domain of human retinoid X receptor alpha expressed in Escherichia coli. 803 15

The binding of transcription factor AP-1 and vitamin D receptor (VDR) to the composite AP-1 plus vitamin-D-responsive promoter region (AP-1 + VDRE) of the human osteocalcin gene was characterized in osteocalcin-producing (MG-63) and non-producing (U2-Os, SaOs-2) human osteosarcoma cell lines. In mobility-shift assays with AP-1 + VDRE, AP-1, and VDRE probes and nuclear extracts from these cells, one AP-1-specific and two VDR-specific (fast and slow mobility) interactions were observed. Characterization of the complexes indicated that AP-1 and VDR do not bind simultaneously to the AP-1 + VDRE oligonucleotide. Intensity of the complexes was greatly influenced by cell density: in MG-63 and SaOs-2 cells, AP-1 binding was strong during the proliferative period disappearing at confluency whereas, in U2-Os cells, AP-1 binding was prominent also at the confluent stage. Furthermore, MG-63 cells possessed the faster migrating VDR complex at all stages of confluency whereas, in U2-Os and SaOs-2 cells, it was very weak or absent. There were no detectable differences in the levels of VDR protein between these cell lines. In U2-Os cells, the level of c-jun mRNA was higher than in the other two cell lines, whereas none of these cell lines exhibited detectable levels of c-fos mRNA at the confluent stage. Exogenous c-Jun protein effectively blocked the VDR-DNA interaction. Further, all these cell lines expressed mRNA for retinoid X receptor alpha (RXR alpha), the factor suggested to be required for the VDR-DNA interaction. The presence of an accessory factor in the VDR-DNA complexes was indirectly shown by treatment of the cells with 9-cis retinoic acid and by cycloheximide. Both treatments reduced VDR binding without affecting the VDR protein level. These results suggest that AP-1 interferes with VDR binding to the AP-1 + VDRE element and that the vitamin D responsiveness of the osteocalcin gene correlates with weak AP-1 binding and strong binding of the faster migrating VDR complex.
...
PMID:Functional interference between AP-1 and the vitamin D receptor on osteocalcin gene expression in human osteosarcoma cells. 807 31

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.
...
PMID:Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors. 812 7

The retinoid X receptor alpha is one of a number of retinoic acid receptors which are members of the steroid/thyroid hormone superfamily. Localization of RXRA was achieved using the polymerase chain reaction on a panel of somatic cell hybrids. A cosmid clone was isolated using the RXRA PCR product, and this was used to further localize the gene by fluorescence in situ hybridization to chromosome 9q34 distal to the dopamine beta hydroxylase gene (DBH). This mapping position was confirmed by PCR on a panel of translocation hybrids.
...
PMID:Localization of the retinoid X receptor alpha gene (RXRA) to chromosome 9q34. 825 89

In order to study how human papillomaviruses (HPVs) can alter normal epithelial cell differentiation, we looked at the response to retinoic acid (RA) of HPV-immortalized keratinocytes grown on organotypic cultures. Ten- to 30-fold higher concentrations of RA were required to block terminal differentiation in these cultures when compared to organotypic cultures of control cells. This resistance to RA was associated with maintained expression of differentiation-specific markers and, for keratin K1, Northern analysis showed that K1 mRNA was also detectable at 30-fold higher concentrations of RA in HPV organotypic cultures when compared to controls. These differences were reproducible and characteristic of all HPV cell lines studied, including very early passage HPV16-containing cell lines, suggesting that expression of HPV genes leads to this phenotype. Expression of epithelia-specific components of the RA response pathway was also studied by Northern analysis. At all RA concentrations, there were no detectable differences in overall levels of retinoic acid receptor gamma or cytosolic RA-binding protein II mRNA found. Retinoid X receptor alpha expression was also evaluated, and, in two of three HPV-immortalized cell lines, it was found to be 2 to 3 times as abundant as in controls. Although this difference in retinoid X receptor alpha expression could contribute to RA resistance, the mechanism involved in producing this resistance could not be fully elucidated in these studies. However, resistance to the effects of RA on epithelial differentiation is demonstrated in organotypic cultures of HPV-containing cells, and it is shown that this is associated with maintenance of RNA and protein expression of differentiation-associated genes at abnormally high concentrations of RA.
...
PMID:Human papillomavirus-immortalized keratinocytes are resistant to the effects of retinoic acid on terminal differentiation. 827 52

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site. 829 96

<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>