Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P10721 (c-kit)
 6,575 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

G-quadruplexes are believed to be potential targets for therapeutic intervention and this has resulted in designing of various quadruplex interacting ligands. Moreover, reports about existence of quadruplex forming sequences across the genome have propelled greater interest in understanding their interaction with small molecules. An intramolecular quadruplex sequence can adopt different conformations, owing to different orientation of loops in the structure. The differences in the loop orientation can affect their molecular recognition. Herein, we have studied the interaction of 5,10,15,20-tetrakis(1-methyl-4-pyridyl)-21H, 23H-porphine (TMPyP4), a well-known G quadruplex binding ligand with three DNA quadruplexes differing in loop orientations. Results obtained from UV, ITC, and SPR studies have coherently revealed that the TMPyP4 molecule shows preferential binding to parallel G-quadruplex ( c-myc and c-kit) over its antiparallel counterpart (human telomeric). The binding affinity for parallel quadruplex was (10(7)) 1 order of magnitude higher than that for antiparallel DNA quadruplex (10 ). The study shows two binding modes, stronger binding (10(7)) of TMPyP4 involving end stacking and a weaker external binding (10 ), while TMPyP4 shows only one binding mode with duplex with a binding affinity of the order of 10(6). Overall, the study emphasizes that differences in the loop orientation give rise to different conformations of quadruplex, which in turn govern its binding to small molecules, and thereby play a pivotal role in molecular recognition.
 ...
PMID:Effect of loop orientation on quadruplex-TMPyP4 interaction. 1855 64

The catalytic domains of protein kinases are commonly treated as independent modular units with distinct biological functions. Here, the interactions between the catalytic and juxtamembrane domains of VEGFR2 are studied. Highly purified preparations of the receptor tyrosine kinase VEGFR2 catalytic domain without (VEGFR2-CD) and with (VEGFR2-CD/JM) the juxtamembrane (JM) domain were characterized by kinetic, biophysical, and structural methods. Although the catalytic parameters for both constructs were similar, the autophosphorylation rate of VEGFR2-CD/JM was substantially faster than VEGFR2-CD. The first event in the autophosphorylation reaction was phosphorylation of JM residue Y801 followed by phosphorylation of activation loop residues in the CD. The rates of activation loop autophosphorylation for the two constructs were determined to be similar. The autophosphorylation rate of Y801 was invariant on enzyme concentration, which is consistent with an intramolecular reaction. In addition, the first biochemical characterization of the advanced clinical compound axitinib is reported. Axitinib was found to have 40-fold enhanced biochemical potency toward VEGFR2-CD/JM (K(i) = 28 pM) compared to VEGFR2-CD, which correlates better with cellular potency. Calorimetric studies, including a novel ITC compound displacement method, confirmed the potency and provided insight into the thermodynamic origin of the potency differences. A structural model for the VEGFR2-CD/JM is proposed based on the experimental findings reported here and on the JM position in c-Kit, FLT3, and CSF1/cFMS. The described studies identify potential functions of the VEGFR2 JM domain with implications to both receptor biology and inhibitor design.
 ...
PMID:Characterizing the effects of the juxtamembrane domain on vascular endothelial growth factor receptor-2 enzymatic activity, autophosphorylation, and inhibition by axitinib. 1952 84

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".
 ...
PMID:Targeting G-quadruplex structure in the human c-Kit promoter with short PNA sequences. 2141 Feb 46