Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
An expression vector was constructed to express foreign genes in Trypanosoma congolense. The foreign gene and a neomycin phosphotransferase (NPT) gene are flanked by glutamate and alanine rich protein (GARP) gene processing signals and their expression is driven by a ribosomal RNA gene promoter. The plasmid is not maintained as an episome in T. congolense, but the NPT gene permits selection of cells in which the plasmid has integrated into the genome. We used this plasmid to express luciferase, green fluorescent protein and a surface protein of Trypanosoma brucei, glycine-proline-glutamate glutamate threonine procyclic acidic repetitive protein (GPEET
PARP
). The plasmid-derived GPEET
PARP
is expressed on the surface of procyclic T. congolense and comigrates on a polyacrylamide gel with native GPEET
PARP
from T. brucei procyclic cells. We also attempted to use the plasmid to overexpress a previously identified T. congolense cysteine protease. The plasmid-derived cysteine protease mRNA species occurs in the transfected cells, but we were unable to detect increased levels of protein or protease activity.
Mol
Biochem Parasitol 1999 Oct 25
PMID:Expression of foreign proteins in Trypanosoma congolense. 1058 80
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (
PARP
). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable
PARP
purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-
PARP
antibody revealed centromeric localization of
PARP
, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged
PARP
-binding region around the core centromere-active domain, suggesting possible 'spreading' of
PARP
into surrounding non-core centromeric domains. Enhanced
PARP
signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome.
PARP
signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of
PARP
binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of
PARP
during S/G(2)phase and that the total proportion of
PARP
that is centromeric is relatively low. Strong binding of
PARP
to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.
Hum
Mol
Genet 2000 Jan 22
PMID:Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase. 1060 29
Oxygen deprivation for prolonged periods leads to cardiac cell death and ventricular dysfunction. The ability to prevent myocardial cell death would be of significant therapeutic value in maintaining cardiac function after injury. While caspases have been suggested to play a critical role in apoptosis, their involvement during hypoxic injury has not been formally determined. In this report, we show that adult ventricular myocytes subjected to hypoxia for 1 h undergo a three-fold increase (P<0.05) in the incidence of apoptosis as determined by TUNEL analysis and Hoechst 33258 nuclear staining. Western blot analysis of hypoxic myocytes revealed a 10-fold increase in the proteolytic processing of caspase 3 to p17 with a concomitant cleavage of the caspase 3 substrate
PARP
from 116 kd to p85 kd compared to normoxic controls. Defects in mitochondrial membrane integrity were also observed as evidenced by the translocation of cytochrome c from the mitochondrial to cytosolic compartment of hypoxic cells. Pretreatment of ventricular myocytes with the peptide-caspase inhibitor known to block caspases related to caspase 1 (Ac-YVAD-CHO) attenuated cytochrome c release, processing of caspase 3, and apoptosis. While the caspase inhibitor (Ac-DEVD-CHO) which blocks caspases related to caspase 3, suppressed the cleavage of
PARP
and apoptosis, it had no effect on cytochrome c release by mitochondria. The data provide direct evidence for the proteolytic activation of caspases during hypoxia-mediated apoptosis of adult ventricular myocytes. Furthermore, the data suggest a hierarchical scheme for caspase activation with mitochondrial cytochrome c release occurring proximally to DEVD-CHO-inhibitable caspases.
J
Mol
Cell Cardiol 2000 Jan
PMID:Caspase activation and mitochondrial cytochrome C release during hypoxia-mediated apoptosis of adult ventricular myocytes. 1065 90
Ischemia/reperfusion leading to myocyte cell death has been reported as either necrotic or apoptotic or a combination of both. The importance of necrosis is well established but the role of apoptosis and the time of initiation are still unknown. Normothermic global ischemia of either 45 or 90 min duration followed by 6 h of reperfusion were induced in isolated canine hearts. After 45 min of ischemia, left ventricular function and adenine nucleotide (AN) content had recovered during reperfusion indicating reversible injury. DNA fragmentation determined by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) was absent as was the 85 kDa fragment of poly-(ADP-ribose) polymerase (
PARP
). After 90 min of ischemia, electron microscopy indicated necrotic cell death in 90% of myocytes. Recovery of function and AN content during reperfusion was minimal. At the end of ischemia, caspase-3 was activated in 30% of all myocytes and
PARP
85 kDa fragments were present by Western blot, indicating initiation of the apoptotic cascade. Lamin-B(1)labeling was significantly reduced from 90% in myocytes in control and ischemia to 30% in early reperfusion. Completion of apoptosis seen by TUNEL was evident in late reperfusion (7.6% of myocytes and 8.3% of non-myocytes). Experiments with 6 h ischemia without reperfusion showed absence of DNA fragmentation. We conclude that apoptotic cell death is initiated by ischemia but that reperfusion is needed for completion of the apoptotic cascade. Furthermore, it is concluded that cell death in acute global ischemia followed by reperfusion occurs predominantly by necrosis and that apoptosis is of minor importance in this pathophysiological situation.
J
Mol
Cell Cardiol 2000 Feb
PMID:Apoptosis is initiated by myocardial ischemia and executed during reperfusion. 1072 97
Fas-induced apoptosis is one form of programmed cell death responsible for hepatocyte demise. However, the role of this cell surface receptor in the death of tumoral hepatic cells is still being debated. It has been shown that some hepatoma cell lines may escape apoptosis because of abnormal Fas localization correlated with non-functionality of the Fas protein or dysfunctionality in the Fas pathway cascade. The aim of this study was to investigate the behaviour of four hepatoma cell lines, HepG2, Hep3B, SKHep1 and Chang-Liver and two extrahepatic cell lines, MCF7, a mammary tumoral cell line and OVCAR-3, an ovarian tumoral cell line, when they were treated with an agonistic anti-Fas antibody alone, with interferon gamma (IFNgamma), an up-regulator of Fas protein expression, alone or with a combination of both agents. We first performed immunofluorescence and flow cytometry to confirm that Fas was present on the cell surface of each cell line in the normal state. Apoptosis was then investigated after induction with the various treatments, by DAPI staining, agarose gel DNA electrophoresis and
PARP
cleavage. Caspase 8 and 3 expression, as well as two anti-apoptotic proteins Bcl-2 and HSP70, and one proapoptotic protein Bax were also investigated by immunoblot allowing identification of several apoptotic pathways based on the behaviour of the different studied proteins. HepG2 and OVCAR-3 cells were sensitive to the anti-Fas antibody alone. Hep3B was resistant to Fas-induced apoptosis but sensitive to IFNgamma-induced apoptosis. MCF7 was resistant to anti-Fas antibody and IFNgamma Chang-Liver and SKHep1 were sensitive to IFNgamma and anti-Fas antibody but at different degrees. Chang-Liver used the Fas and IFNgamma pathways, while SKHep1 involved mostly the Fas pathway. These results show that each tumor cell line is characterized by different apoptotic behaviour in relation to Fas and/or IFNgamma-induced apoptosis. In addition, despite the high level of Bcl-2 and HSP70 proteins in the tumoral cells investigated here, they were not fully protected against apoptosis, except for MCF7. This emphasizes the necessity to analyse the different proteins responsible for apoptosis to adapt anti-tumoral therapeutics.
Cell
Mol
Biol (Noisy-le-grand) 2000 Feb
PMID:Apoptotic behaviour of hepatic and extra-hepatic tumor cell lines differs after Fas stimulation. 1072 68
We have analyzed the type of cell death occurring in human normal ejaculated spermatozoa. Sperm cells were prepared either by centrifugation alone (group 1) or by density gradient centrifugation (group 2) and were cultured for 24 hrs. Cells were examined after 4 and 24 hrs. By comparison unprepared spermatozoa were used as a control group. Necrosis was investigated by intra-cellular vital stain penetration and electron microscopy. Apoptosis was researched by DAPI staining, annexin V-binding, electron microscopy, DNA fragmentation and
PARP
cleavage. In group 1, after 4 hrs., there was a mixture of spermatozoa dead either by necrosis or apoptosis while after 24 hrs., necrosis was prominent. Similar findings were observed in the control group. In contrast, in group 2 apoptosis was the major form of cell death of spermatozoa after 24 hrs. of culture. These findings suggest that apoptosis can be an important factor when spermatozoa are used for assisted reproductive technologies.
Cell
Mol
Biol (Noisy-le-grand) 2000 Feb
PMID:Morphological and biochemical analysis of cell death in human ejaculated spermatozoa. 1072 84
Poly(ADP-ribose) polymerase (
PARP
I) and Topoisomerase I (Topo I) were reisolated from calf thymus to eliminate cross contamination as tested by immunotransblots. The specific activity of Topo I was greatly increased by added
PARP
I, following saturation kinetics. Recombinant
PARP
I and isolated
PARP
I at final purity were indistinguishable in terms of their activation of Topo I. There was a coincidence of experimentally obtained binding constants and computer generated values based on the kinetic model, indicating that the association of
PARP
I and Topo I is rate limiting in the catalytic activation of Topo I by
PARP
I. Polypeptide domains of
PARP
I that are required for protein-protein binding and protein-DNA binding also activate Topo I. Fluorescence resonance energy transfer between fluorophor-labeled
PARP
I and Topo I was demonstrated. The binding of Topo I to circular SV40 DNA, assayed either by the formation of a) the sum of non-covalently and covalently attached Topo I to DNA or b) by the covalently bound transient intermediate in the presence of camptothecin, was augmented when
PARP
I protein was bound to SV40 DNA. These binding experiments provide a molecular basis for the kinetic activation of Topo I by
PARP
I inasmuch as the increased superhelicity of SV40 DNA induced by
PARP
I may facilitate the formation of a more <tight fisted> Topo I-DNA complex that increases the rate of the DNA breakage-reunion cycle of Topo I catalysis.
Int J
Mol
Med 2000 May
PMID:Activation of topoisomerase I by poly [ADP-ribose] polymerase. 1076 58
Poly (ADP-ribose) polymerase (
PARP
) is an abundant chromatin associated protein important in DNA repair, maintenance of chromosomal stability and programmed cell death. Here we report that an increase in caspase 3-activity and cleavage of
PARP
serves as an early execution phase signal in human neuroblastoma. Human neuroblastoma SK-N-SH cells were exposed to a protein kinase inhibitor, staurosporine, or a topoisomerase II inhibitor, etoposide, at various concentrations and time points. Cells exposed to staurosporine (0.1 microM) for 30 min showed an increase in caspase 3-activity and by 1 h an increase in
PARP
116-kDa band and an 85-kDa cleavage product, which further increased in density with time after treatment. Quantitative analysis for condensed chromatin material using bisbenzimide, and DNA fragmentation enzyme immunoassays showed a significant increase in apoptosis 5 h after staurosporine treatment. This was further confirmed with a Klenow fragment of DNA polymerase I assay which primarily detects single-stranded DNA breaks. A significant decrease in mitochondrial metabolism occurred within 8-12 h after treatment. Studies using Trypan Blue exclusion, and lactic dehydrogenase (LDH) release revealed a significant increase in membrane permeability 8 h after staurosporine (0.1 microM) or etoposide (10 microM) treatments. Cleavage of lamin B1, a protein important in maintaining the nuclear envelope integrity was observed 12 h after staurosporine treatment. Our results show that activation of caspase 3 followed by
PARP
cleavage occur at much earlier time point than any other morphological or biochemical parameters of apoptosis or cytotoxicity.
Brain Res
Mol
Brain Res 2000 Mar 29
PMID:Poly (ADP-ribose) polymerase induction is an early signal of apoptosis in human neuroblastoma. 1076 13
The poly(ADP-ribosyl)ation system, associated with different nuclear fractions of rat testis, has been analyzed for both pADPR and pADPR acceptor proteins. The DNase I sensitive and resistant chromatin contain 35% and 40%, respectively, of the total pADPR synthesized in intact nuclei incubated with [32P]NAD. Moreover, the residual 25% were estimated to be associated with the nuclear matrix. Three different classes of pADPR are present in the nuclei. The longest and branched ADPribose polymers modify proteins present in the DNase I resistant (2 M NaCl extractable) chromatin and in the nuclear matrix, whereas polymers of> 20 residues interact with the components of the DNase I sensitive chromatin and oligomers of 6 ADPribose residues are bound specifically to the acid-soluble chromosomal proteins, present in isolated nuclear matrix. The main pADPR acceptor protein in all the nuclear fractions is represented by the
PARP
itself (auto-modification reaction). The hetero-modification reaction occurs mostly on histone H1 and core histones, that have been found associated to DNase I sensitive and resistant chromatin, respectively. Moreover, an oligo(ADP-ribosyl)ation occurs on core histones tightly-bound to the matrix associated regions (MARs) of chromatin loops.
Mol
Cell Biochem 2000 Feb
PMID:The analysis of the poly(ADPR) polymerase mode of action in rat testis nuclear fractions defines a specific poly(ADP-ribosyl)ation system associated with the nuclear matrix. 1082 26
E2F -1 is a transcription factor that regulates cell cycle progression into S-phase. Deregulation of E2F-1 activity has been associated with cellular commitment to apoptosis. Also critical in the regulation of S-phase are the actions of the cyclin dependent kinases, Cdk2 and cdc2. Inhibition of these cyclin dependent kinases has been similarly associated with disrupting orderly S-phase progression and causing subsequent apoptosis in certain cancer cells. In this study, we examine the ability of adenovirus-mediated E2F-1 overexpression to induce apoptosis in human gastric carcinoma cells. Furthermore, we investigate the effect of the cyclin dependent kinase inhibitors, olomoucine and roscovitine, on E2F-1-mediated apoptosis in human gastric carcinoma cells. AGS and SNU-1 gastric adenocarcinoma cells were infected with adenoviral vectors expressing E2F-1 (Ad5CMVE2F-1) or control viruses expressing beta-galactosidase (Ad5CMVLacZ) or lacking a transgene (Ad5). Gastric adenocarcinoma cells were then independently treated with roscovitine or olomoucine. Finally, gastric adenocarcinoma cells were infected with the various adenoviral vectors in combination with roscovitine or olomoucine. E2F-1 overexpression resulted in an 85% reduction in cell viability at 72 h compared to controls. Combining E2F-1 overexpression with roscovitine resulted in >99% reduction in cell viability by 72 h. Overexpression of E2F-1 resulted in premature S-phase entry and G2/M arrest at 24 h, followed by apoptosis by 72 h. Combining E2F-1 overexpression with roscovitine resulted in an earlier G2/M arrest, followed by a more complete, widespread apoptotic response by 24 h. Caspase 3/CPP32 activation and
PARP
cleavage in response to E2F-1 overexpression, alone and in combination with roscovitine, implicate the caspase cascade in E2F-1-mediated apoptosis of gastric cancer cells. Bax levels also increased in response to E2F-1 gene transfer, alone and in combination with roscovitine. E2F-1 overexpression induces widespread apoptosis in human gastric carcinoma cells. Combining E2F-1 overexpression with cyclin-dependent kinase inhibitors results in an enhanced apoptotic response, causing nearly complete gastric tumor cell death within 72 h. E2F-1 gene therapy in combination with cyclin dependent kinase inhibitors is a potentially active chemogene therapy strategy for the treatment of human gastric cancer.
Int J
Mol
Med 2000 Jul
PMID:Adenovirus-mediated E2F-1 gene transfer induces an apoptotic response in human gastric carcinoma cells that is enhanced by cyclin dependent kinase inhibitors. 1085 Dec 67
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>