Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
High-resolution proton and phosphorus nuclear magnetic resonance studies are reported on the self-complementary d(C1-G2-N3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) duplexes (henceforth called O6meG X A 12-
mer
when N3 = A3 and O6meG X G 12-
mer
when N3 = G3), which contain symmetry-related A3 X O6meG10 and G3 X O6meG10 interactions in the interior of the helices. We observe inter-base-pair nuclear Overhauser effects (NOE) between the base protons at the N3 X O6meG10 modification site and protons of flanking G2 X C11 and G4 X C9 base-pairs, indicative of the stacking of N3 and O6meG10 bases in both O6meG X A 12-
mer
and O6meG X G 12-
mer
duplexes. We have assigned all the base and a majority of the sugar protons from two-dimensional proton-correlated and nuclear Overhauser effect experiments on the O6meG X A 12-
mer
duplex and O6meG X G 12-
mer
duplex in solution. The observed NOEs establish that the A3 and O6meG10 at the modification site and all other residues adopt the anti configuration about the glycosidic bond, and that the O6meG X A 12-
mer
forms a right-handed duplex. The interaction between the bulky purine A3 and O6meG10 residues in the anti orientation results in large proton chemical shift perturbations at the (G2-A3-G4) X (C9-O6meG10-C11) segments of the helix. By contrast, we demonstrate that the O6meG10 residue adopts a syn configuration, while all other bases adopt an anti configuration about the glycosidic bond in the right-handed O6meG X G 12-
mer
duplex. This results in altered NOE patterns between the base protons of O6meG10 and the base and sugar protons of flanking C9 and C11 residues in the O6meG X G 12-
mer
duplex. The phosphorus backbone is perturbed at the modification site in both duplexes, since the phosphorus resonances are dispersed over 2 parts per million in the O6meG X A 12-
mer
and over 1 part per million in the O6meG X G 12-
mer
compared to a 0.5 part per million dispersion for an unperturbed DNA helix. We propose tentative pairing schemes for the A3 X O6meG10 and G3 X O6meG10 interactions in the above dodecanucleotide duplexes.
J
Mol
Biol 1986 Apr 20
PMID:Covalent carcinogenic O6-methylguanosine lesions in DNA. Structural studies of the O6 meG X A and O6meG X G interactions in dodecanucleotide duplexes. 301 88
We isolated and characterized LP1.2, a mouse myeloma mutant with a deletion of at least 4 kilobases (kb) immediately 3' of the alpha gene and introduction of at least 5 kb of novel (nonimmunoglobulin) sequence in its place. A 6.2-kb genomic EcoRI fragment from the mutated allele was cloned, and a subfragment was sequenced. The deletion begins 11 base pairs (bp) beyond the normal site of cleavage and polyadenylation for the secreted form of alpha mRNA. A short direct repeat, eight copies of the 17-
mer
GCCT ATAGAAGTAAGGA, is located at the junction of the alpha and novel sequences. The first 4 bp of the 17-
mer
are identical to the last 4 bp of the alpha sequence. Novel sequences downstream of the direct repeats in LP1.2 include a low-copy-number sequence flanked by two distinct, highly repetitive elements. The low-copy-number portion of the novel sequence appears on a single 30-kb EcoRI fragment in several myelomas and in liver DNA; one copy of this fragment has rearranged in cell line W3129, and this allele has rearranged a second time in LP1.2. LP1.2 contains low levels of apparently normal alpha protein and mRNA. The S1 nuclease protection of nuclear and cytoplasmic RNAs shows that cleavage and polyadenylation are efficient and accurate and that they occur without the accumulation of aberrant transcripts. Alpha transcription in isolated nuclei is decreased sevenfold in LP1.2 relative to its parent, which accounts for the low steady-state levels of cytoplasmic alpha mRNA and protein in LP1.2. Decreased alpha transcription could result either from the deletion of a positive regulator in the 3' flanking region or from the introduction of novel sequences which exert a negative effect.
Mol
Cell Biol 1986 Jun
PMID:Myeloma mutant with a novel 3' flanking region: loss of normal sequence and insertion of repetitive elements leads to decreased transcription but normal processing of the alpha heavy-chain gene products. 302 10
Random minicircle DNA molecules were released from isolated kinetoplast network DNA of Trypanosoma congolense by BamHI digestion and cloned into plasmid pUC19. The sequences of two cloned minicircles (958 bp and 964 bp) were determined. Both minicircles contain the 13 bp sequence, 5'-GGGGTTGGTGTAA-3', thought to be the replication origin of minicircles in other trypanosomatids. The two minicircles have extensive homology in the 120 bp preceeding, and the 20 bp following, this 13-
mer
but only scattered homology elsewhere. Both possess tandem repeats downstream of the 13-
mer
. Comparison of these minicircles with minicircle sequences from other trypanosomatids reveals that they have the same general sequence organization as the others although only the 13-
mer
and its flanking regions are homologous.
Mol
Biochem Parasitol 1987 Jul
PMID:Sequences of two kinetoplast minicircle DNAs of Trypanosoma (Nannomonas) congolense. 304 Dec 15
Two crystal forms of the self-complementary DNA 12-
mer
d(CGTAGATCTACG) were grown by the vapour diffusion technique. Form I is in space group C2 with a = 64.8 A, b = 35.4 A, c = 24.4 A and beta = 92.2 (1 A = 0.1 nm). The crystals are grown as monoclinic blocks or hexagonal plates. There are two strands (one duplex) in the asymmetric unit. Form II crystallizes as monoclinic blocks, space group P21 with a = 64.5 A, b = 35.1 A, c = 25.2 A and beta = 91.8 degrees. This form contains four strands (2 duplexes) in the asymmetric unit. Both forms are suitable for high resolution X-ray analysis. The diffraction patterns suggest that the DNA is in a B-type conformation and that the packing in the two forms is very similar.
J
Mol
Biol 1988 Aug 20
PMID:Crystallization and preliminary analysis of the deoxyoligonucleotide d(CGTAGATCTACG). 317 42
The binding of alpha-bungarotoxin to several synthetic peptides comprising different segments of the region 173-204 of the alpha subunit of the Torpedo acetylcholine receptor was investigated to further localize the neurotoxin-binding site on the primary sequence. When tested in a solid phase microwell assay system, a 32-amino acid peptide corresponding to residues 173-204 (32-mer) bound 125I-alpha-bungarotoxin with the same affinity (4.2 x 10(-8) M as determined from IC50 values) as the isolated alpha subunit (4.6 x 10(-8) M). The relative affinities of other antagonists (alpha-cobratoxin, d-tubocurarine) maintained the same rank order in this assay system as has been demonstrated with the intact receptor. Agonists competed with binding of toxin at millimolar concentrations but lost all rank order of potency. These findings demonstrate that peptide 173-204 contains many of the antagonist-binding determinants present on denatured alpha subunit but has lost specificity of agonist binding. To further localize the toxin-binding site, alpha-bungarotoxin binding to seven shorter peptides corresponding to portions of the 32-
mer
was investigated. 125I-alpha-Bungarotoxin bound to alpha subunit peptides 179-192, 181-198, 185-196, 186-196, and 193-204, but not to alpha subunit peptides 173-180 and 194-204. In a second assay, all of the peptides competed with binding of 125I-acetylcholine receptor to immobilized alpha-bungarotoxin. The apparent affinity was highest for the 173-204 32-
mer
(1.4 x 10(-7) M) and lowest for peptides 173-180 and 194-204 (greater than 10(-4) M). The affinity of the other peptides was intermediate (approximately 10(-5) M) and about 100-fold less than that of the 32-
mer
. The affinity of alpha-bungarotoxin was 3.5 x 10(-10) M, of isolated, native acetylcholine receptor, 3.2 x 10(-9) M, and of isolated denatured subunit, 1.2 x 10(-8) M, with this assay. The retention of some toxin-binding capacity by the shorter peptides indicates toxin-binding determinants are distributed over the entire length of the 32-
mer
. The determinants with higher affinity are located in the central region of the 32-
mer
between residues 179 and 196.
Mol
Pharmacol 1988 Nov
PMID:Distribution of alpha-bungarotoxin binding sites over residues 173-204 of the alpha subunit of the acetylcholine receptor. 319 56
The 17-
mer
oligonucleotide probe homologous to the fragment of the gene for human erythrocyte differentiation factor erythropoietin was used to screen the human genomic library for this gene. Restriction analysis and partial sequencing of one of the identified clones have confirmed that the clone does contain the human erythropoietin gene. We are planning to use the cloned human erythropoietin gene for developing a stably transfected mammalian cell line that should secrete erythropoietin.
Mol
Gen Mikrobiol Virusol 1988 Jul
PMID:[Cloning of human erythropoietin gene]. 319 67
We have modified current methods to create a very efficient technique for cloning cDNAs in a defined orientation, into plasmid vectors bearing phage SP6 and T7 polymerase promoters. First strand synthesis is primed at the poly(A) tail with a 26-
mer
synthetic oligonucleotide linker/primer, the RNA is hydrolyzed and the cDNA is tailed with 10 to 15 dG residues. The cDNA is then annealed to two prepared vector fragments specific for the two ends of the cDNA (one bearing a dC10-15 tail and the other bearing a 14-nucleotide cohesive end complementary to the linker/primer). After ligation the second strand is synthesized with the large fragment of DNA polymerase I. Libraries of up to 8 x 10(6) independent transformants have been obtained from 1 microgram of Drosophila poly(A)+ RNA. The design of the method and careful optimization of first strand synthesis have permitted cloning of several large (4.3 to 6.5 kb), low abundance cDNAs. Transcription of essentially full-length clones with phage SP6 RNA polymerase produces RNAs that are efficiently translated in vitro to give complete, unfused products, thus permitting rapid characterization of the clones via the encoded polypeptides. Antisense RNAs can also be produced by transcription with phage T7 RNA polymerase.
J
Mol
Biol 1988 Sep 20
PMID:Functional cDNA libraries from Drosophila embryos. 319 41
Complexes of 9-aminoacridine and two derivatives with oligomers based on the sequence of a hot spot for frame-shift mutations, 5'dGATGGGGCAG, are investigated by proton NMR and equilibrium dialysis. Competition dialysis experiments show that the drug binds bulge-containing oligomers more strongly than regular duplexes of similar sequence and length, with one apparent strong site. A duplex containing an extra cytidine in a run of C's has the highest affinity for 9-aminoacridine among the sequences tested. An oligomer containing five consecutive G.C pairs shows cooperative drug binding, indicating that G tracts of this length may have an altered helical structure. Complexes of a regular 8-
mer
and a 9-
mer
containing a bulged guanosine are examined in detail by two-dimensional NMR techniques. 9-Aminoacridine preferentially binds at TpG sites in the 8-
mer
but binds primarily at the bulged guanosine in the G-bulge 9-
mer
. Drug-DNA NOE's in the 8-
mer
complex are compared with the crystal structure of 9-aminoacridine and 5-iodo-CpG [Sakore et al. (1979) J.
Mol
. Biol. 135, 763-785]. The NMR data suggest that the drug intercalates across the base pairs of both strands with the amino group projecting into the minor groove.
...
PMID:Binding of 9-aminoacridine to bulged-base DNA oligomers from a frame-shift hot spot. 323 12
We have assigned the majority of the nonexchangeable protons in the NMR spectrum of the 20 base-pair fragment of DNA corresponding to the Trp operator of Escherichia coli. The sequence (CGTACTAGTTAACTAGTACG) also contains a Pribnow box (underlined). Variation of the intrinsic spin-lattice relaxation rate constants of the H8's along the sequence indicates that the structure of the oligonucleotide is not regular. Splitting patterns of the H1' resonances in the deoxyriboses, obtained from a two-dimensional J-resolved experiment, allowed the dominant pucker mode of each nucleotide to be determined. Intranucleotide NOEs from the sugar protons H1', H2', and H3' to the base protons were used to determine the conformation of each nucleotide (puckers and glycosidic torsion angles). The relative orientations of nucleotide units (roll, propeller twist, helical twist angle, and pitch) were calculated by using internucleotide NOEs between protons of neighboring nucleotides in the sequence. All these parameters were determined for each step along the 20-
mer
. The structure belongs to the B family of conformations, but variations of the local geometry are observed from step to step. Some of the variations, such as the roll and the twist angles, can be predicted by the rules of Calladine and Dickerson [Calladine, C. R., & Dickerson, R. E. (1983) J.
Mol
. Biol. 166, 419-441]. The puckers of the deoxyriboses of purines are found mainly in conformations near C2' endo, while those of the pyrimidines prefer C3' endo and related conformations. Glycosidic torsion angles obtained for purines are larger than those of pyrimidines. Except for this last observation, the general properties of the operator DNA structure are comparable with those of crystal structures of B DNA of other sequences.
...
PMID:Solution structure of the Trp operator of Escherichia coli determined by NMR. 331 Nov 61
The kidneys of teleost fish are associated with tissues containing secretory granules--the corpuscles of Stannius (CS). Electron microscopy indicates that the granules are of a proteinaceous nature and may represent hormones or enzymes of unrecognized physiological and biochemical function. In the present study, two-dimensional gel electrophoresis and electroelution was used to purify the major protein to homogeneity; it is approximately 32,000 Da in the reduced form and glycosylated. From the partial NH2-terminal sequence, a 75-
mer
oligonucleotide probe was synthesized and used to isolate a cDNA clone from which the complete amino acid sequence of the major CS protein was deduced. Polyclonal antibodies raised against CS homogenates were specific for the CS proteins (confirmed by immunohistochemistry). Hybridization histochemistry was used to confirm the location of the mRNA encoding the isolated protein. Incubation of CS homogenate with eel plasma or ovine renin substrate did not result in any angiotensin-like peptides whereas kidney homogenate did.
Mol
Cell Endocrinol 1987 Dec
PMID:Purification and cloning of a corpuscles of Stannius protein from Anguilla australis. 331 39
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>