Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (
PC-3
/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in
PC-3
/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
Mol
Cell Endocrinol 2000 Dec 22
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97
Androgen receptor (AR) signalling was analysed using as models the cysteine-rich secretory protein-1 (CRISP-1) and CRISP-3 gene promoters, which are differentially regulated by androgen in vivo and contain multiple potential androgen response elements. Using electrophoretic mobility shift assay, we identified several elements with differing affinities for the AR at positions -3706, -1270, -1253 and -350 of the CRISP-1 promoter and at positions -369 and -349 of the CRISP-3 promoter. The strongest binding was observed for the -1253 element of CRISP-1. In transactivation assays using a
PC-3
cell line stably transfected with the AR (
PC-3
/AR), the -1253 element placed as two or four copies upstream of the TK minimal promoter yielded a strong induction of luciferase reporter gene activity in the presence of the androgen methyltrienolone (R1881). In the context of the CRISP promoters a 2-fold induction by R1881 was measured for the CRISP-3 upstream region whereas only limited effects were noted for the CRISP-1 upstream region. The androgenic stimulation of the p(-1253 ARE)(4x)-TK-luciferase reporter construct was dose-dependently inhibited by geldanamycin and radicicol, two compounds that selectively interact with the chaperone protein, heat-shock protein 90. Cotransfection with an expression vector for the 14-3-3eta protein markedly enhanced the androgen-dependent stimulation. These results emphasize the influence of promoter context on androgen regulation and the importance of AR-associated proteins.
Mol
Cell Endocrinol 2001 Feb 28
PMID:Androgen receptor signalling: comparative analysis of androgen response elements and implication of heat-shock protein 90 and 14-3-3eta. 1122 78
RET fused gene (RFG)/ELE1alpha/androgen receptor-associated protein 70(ARA70) was first found to be involved in the activation of the RET proto-oncogene in thyroid neoplasm and has recently been shown to be a ligand-dependent transcriptional coregulator for androgen receptor (AR). The functionality of RFG/ELE1alpha/ARA70 remains controversial, and little is known about factors regulating its expression in the prostate. Of significant interest is whether this molecule is involved in prostate carcinogenesis. Using reverse transcriptase-polymerase chain reaction semiquantitation, we compared RFG/ELE1alpha/ARA70 mRNA levels in four prostate cancer cell lines (LNCaP, TSU-Pr1, DU-145, and
PC-3
) with those found in primary cultures of normal prostatic epithelial cells (PrECs). In addition, we examined the effects of androgen and antiandrogen, estrogen and antiestrogen, and a demethylating agent on RFG/ELE1alpha/ARA70 mRNA expression levels in AR- and AR+
PC-3
cells. Reduced levels of RFG/ELE1alpha/ARA70 message were observed in all four prostate cancer cell lines when compared with normal PrECs in primary cultures. RFG/ELE1alpha/ARA70 mRNA levels in
PC-3
cells, which express both estrogen receptor subtypes, were upregulated by 17beta-estradiol and inhibited by the antiestrogen ICI-182780. In
PC-3
(AR+) cells, which were genetically engineered to express AR, exposure to androgen upregulated RFG/ELE1alpha/ARA70 mRNA expression, whereas treatment with 4-hydroxyflutamide lowered expression of this transcript. Furthermore, treatment of DU-145 cells, which did not express RFG/ELE1alpha/ARA70 transcripts, with a demethylating agent reactivated transcription of this gene. Polymerase chain reaction analyses of monochromosomal human-rodent hybrid panels localized a putative RFG/ELE1alpha/ARA70 isoform on human chromosome 5q31.1-31.2. In summary, we identified sex hormones and DNA hypermethylation as regulators of RFG/ELE1alpha/ARA70 expression in prostate cancer cells. In addition, we found reduced levels of RFG/ELE1alpha/ARA70 expression in prostate cancer cell lines when compared with expression levels in normal PrECs in culture. These findings suggest that RFG/ELE1alpha/ARA70 may be involved prostate carcinogenesis and that it may serve as a key mediator of estrogen-androgen synergism.
Mol
Carcinog 2001 Jan
PMID:Expression of RFG/ELE1alpha/ARA70 in normal and malignant prostatic epithelial cell cultures and lines: regulation by methylation and sex steroids. 1125 59
The low-affinity nerve growth factor receptor p75(NTR) is a 75-kDa glycoprotein that belongs to the tumor necrosis factor receptor superfamily and has been implicated in the induction of apoptosis in various tissues and cell lines. Immunohistochemistry on tissue sections from radical prostatectomies has shown that expression of p75(NTR) is limited to the epithelial cells. Western blot and immunohistochemical analyses have also shown a progressive loss of p75(NTR) expression in prostate epithelial cells during the malignant progression of organ-confined adenocarcinomas, with complete loss of expression in the naturally occurring prostate tumor cell lines DU-145,
PC-3
, LNCaP, and TSU-pr1, which were derived from metastases. Reintroduction of p75(NTR) expression into the TSU-pr1 tumor cell line was shown to reestablish the ability of these cells to undergo p75(NTR)-mediated apoptosis. It is not known whether this loss of expression is due to deletion of part or the entire p75(NTR) gene or to other factors. Through the use of southern blotting and polymerase chain reaction (PCR), we showed that loss of p75(NTR) protein expression was not due to deletion or loss of the gene. Furthermore, through reverse transcription-PCR, RNase protection, and the chromatin immunoprecipitation assay, we showed that transcription of the p75(NTR) gene occurred in these prostate tumor cell lines. Finally, through transient transfection using two constructs of p75(NTR), one containing the full 2-kb 3' untranslated region and one that contains only a few hundred bases of the 3' untranslated region (UTR), we showed that the 3' UTR may have a role in the loss of p75(NTR) expression in prostate cancer.
Mol
Carcinog 2001 May
PMID:Molecular characterization of the loss of p75(NTR) expression in human prostate tumor cells. 1139 97
Locally secreted growth factors and neuropeptides may play an important role in sustaining the growth of hormone-independent prostate cancer. Our previous studies have shown that calcitonin-like immunoreactive peptide (CTI) is secreted by primary prostate cells in culture, and its secretion from malignant prostate cells is significantly higher than benign cells. Exogenously added calcitonin (CT) induces DNA synthesis in serum-starved prostate cancer LNCaP and PC-3M cells. Present studies extended these findings by cloning cDNAs for CT and CT receptor (CT-R) from prostate cancer cells and studying the expression of CT and CT-R mRNA in prostate cancer cell lines and primary prostate tumor specimens. The results have shown that
PC-3
cells expressed CT, and not CT-R, mRNA, whereas CT-R, but not CT, mRNA was expressed by LNCaP cells. Conditioned media from
PC-3
cells induced DNA synthesis of LNCaP cells, and this mitogenic response was abolished by anti-CT serum. Highly aggressive PC-3M cells co-expressed CT and CT-R mRNAs. CT also induced a twofold increase in DNA synthesis of primary prostate cells and anti-CT serum caused a 56% decline. In-situ hybridization histochemistry of archival prostate specimens has selectively localized CT and CT-R mRNA in basal epithelium of benign and low grade PC specimens, and these mRNAs were not detected in either luminal epithelium or stroma. In contrast, CT and CT-R mRNA were detected throughout the luminal epithelium of moderate and high-grade PC specimens. Most epithelial cells of low and moderately differentiated tumors expressed either CT or CT-R mRNA, suggesting that CT may serve as a paracrine factor. In contrast, CT and CT-R mRNAs were co-expressed by most tumor cells in advanced PC specimens. The cells expressing CT-R mRNA in primary tumors also co-expressed PCNA. These results, when combined with mitogenic actions of CT on primary prostate cells as well as PC cell lines, strongly support the role for CT in sustaining the growth of cancer cells.
Mol
Cell Endocrinol 2001 Jul 05
PMID:Calcitonin is a prostate epithelium-derived growth stimulatory peptide. 1147 42
The Pem homeobox transcription factor is expressed under androgen control in the testis and epididymis. It is also transcribed in the ovary, muscle, and placenta. The mouse Pem gene promoter was cloned and sequenced. It was analyzed in transactivation tests using CV-1 and
PC-3
cells expressing the AR and found to be strongly stimulated by androgens. EMSAs and mutational analysis of the Pem promoter allowed the identification of two functional androgen response elements named ARE-1 and ARE-2. They both differed from the consensus semipalindromic steroid response element and exhibited characteristics of direct repeats of the TGTTCT half-site. Unlike the steroid response element, both Pem androgen response elements were selectively responsive to androgen stimulation. Specific mutations in the left half-site of Pem ARE-1 and ARE-2, but not of the steroid response element, were still compatible with AR binding in the EMSA. In addition, Pem ARE-1, but not ARE-2 or the steroid response element, showed some flexibility with regard to spacing between half-sites. These results strongly suggest that the AR interacts differently with direct repeats than with inverted repeats, potentially leading to cis element-driven selective properties. Thus, the existence of several classes of DNA response elements might be an essential feature of differential androgen regulation.
Mol
Endocrinol 2001 Oct
PMID:New androgen response elements in the murine pem promoter mediate selective transactivation. 1157 12
Human metallothioneins (MTs) are low-molecular-weight, cysteine-rich, metal ion-binding proteins that constitute the majority of intracellular protein thiols. They are overexpressed in prostate and ovarian cancers and are believed to confer resistance to radiation and cytotoxic anticancer drugs. The aim of this study was to investigate the roles of MTs in prostate and ovarian cancer cells and their possible relationship with other cancer development and progression factors. The main problem in investigating the role of MT, however, is the absence of any known specific inhibitor. To this end, in a previous study, we had developed sequence-specific ribozymes (Rzs) targeting MT and had shown their in cellulo efficacy. Here we show that transient transfection of a vector carrying a hammerhead Rz (Rz4-9), designed to cleave class II MT, in the human prostate cancer cell line
PC-3
and the ovarian cancer cell line SKOV-3 resulted in a dose-dependent attenuation of MT-II(a) transcripts and dramatic cell loss. Transient transfection with 2 microg of Rz4-9 vector DNA completely abolished MT-II(a) mRNA levels and induced a 94% and a 67% reduction in cell number in
PC-3
cells and SKOV-3 cells, respectively. Fluorescence-activated cell sorting (FACS) showed that the Rz-induced cell loss probably was due to apoptosis, because it was associated with marked increases in the hypodiploid cell population, reaching maximums of 52% and 64% in cultures of
PC-3
and SKOV-3, respectively. Additionally, annexin V-propidium iodide double-staining, followed by FACS, confirmed that Rz4-9-induced cell death was due to apoptosis and showed a vector DNA-dependent increase in late apoptotic cell numbers that reached maximums of 80% and 42%, respectively, in
PC-3
and SKOV-3 cell cultures transfected with the highest concentration of vector DNA. In parallel experiments, transfection with a vector containing the enzymatically inactive mutant Rz-3-3 or the empty vector was not effective in inducing similar responses. The Rz-induced loss of MT-II(a) mRNA-associated cell death in these cancer cell lines was attended by dose-dependent downregulation of the proto-oncogene c-myc and the apoptosis inhibitory mediator bcl-2, suggesting that these signaling pathways are involved in the process. In conclusion, our data indicate that MT-II(a) is an important cell-survival or anti-apoptotic factor for prostate and ovarian cancer cells and that downregulation of its expression via transgene expression of a sequence-specific Rz is a feasible target for cancer therapy.
Mol
Carcinog 2002 Jan
PMID:Ribozyme-mediated downregulation of human metallothionein II(a) induces apoptosis in human prostate and ovarian cancer cell lines. 1180 57
We identified a novel mouse gene, mRTVP-1, as a p53 target gene using differential display PCR and extensive promoter analysis. The mRTVP-1 protein has 255 amino acids and differs from the human RTVP-1 (hRTVP-1) protein by two short in-frame deletions of two and nine amino acids. RTVP-1 mRNA was induced in multiple cancer cell lines by adenovirus-mediated delivery of p53 and by gamma irradiation or doxorubicin both in the presence and in the absence of endogenous p53. Analysis of RTVP-1 expression in nontransformed and transformed cells further supported p53-independent gene regulation. Using luciferase reporter and electrophoretic mobility shift assays we identified a p53 binding site within intron 1 of the mRTVP-1 gene. Overexpression of mRTVP-1 or hRTVP-1 induced apoptosis in multiple cancer cell lines including prostate cancer cell lines 148-1PA, 178-2BMA,
PC-3
, TSU-Pr1, and LNCaP, a human lung cancer cell line, H1299, and two isogenic human colon cancer cell lines, HCT116 p53(+/+) and HCT116 p53(-/-), as demonstrated by annexin V positivity, phase-contrast microscopy, and in selected cases 4',6'-diamidino-2-phenylindole staining and DNA fragmentation. Deletion of the signal peptide from the N terminus of RTVP-1 reduced its apoptotic activities, suggesting that a secreted and soluble form of RTVP-1 may mediate, in part, its proapoptotic activities.
Mol
Cell Biol 2002 May
PMID:mRTVP-1, a novel p53 target gene with proapoptotic activities. 1197 68
Parathyroid hormone-related protein (PTHrP) is expressed by prostate cancer cells. Since PTHrP increases prostate cancer cell growth and enhances the osteolytic effects of prostate cancer cells, it is important to control PTHrP expression in prostate cancer. Vitamin D exerts a protective effect against prostate cancer through its antiproliferative actions. We investigated whether this steroid also downregulates PTHrP gene transcription, using the human prostate cancer cell line
PC-3
as a model system. We report that PTHrP mRNA and secreted protein levels are downregulated by 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) via a transcriptional mechanism. We also show that PTHrP gene expression is upregulated, also via a transcriptional mechanism, by epidermal growth factor (EGF), which is normally secreted by prostate cancer cells. 1,25(OH)(2)D(3) reversed the EGF-induced PTHrP upregulation at both the mRNA and protein levels. Since PTHrP enhances prostate cancer cell growth, this study demonstrates the importance of maintaining adequate levels of 1,25(OH)(2)D(3).
Mol
Cell Endocrinol 2002 Apr 25
PMID:Regulation of PTH-related protein gene expression by vitamin D in PC-3 prostate cancer cells. 1199 85
In cloning tyrosine kinase genes in dog prostate cells, a fragment of the vascular endothelial growth factor (VEGF) receptor 1 or Flt-1 was sequenced. To test for a functional protein, Flt-1 antibodies were used to probe immunoprecipitated tyrosine phosphorylated proteins. Western blotting revealed a major 170-180 kDa band and a few bands below 116 kDa in dog prostate and human prostatic carcinoma
PC-3
cells, with higher levels in
PC-3
. Similar results were obtained with human placental membranes used as a source of Flt-1. That the major Flt-1 tyrosine phosphorylated protein was likely VEGF-R1 and part of VEGF signaling pathways was shown by enhanced level of only this protein when
PC-3
cells were exposed to VEGF. Accordingly specific cell surface receptor complexes, displaced by VEGF but not EGF and compatible with Flt-1 in size, were revealed by chemical cross-linking after 125I-VEGF binding. Similarly to the prostatic neuroproduct, gastrin-releasing peptide/bombesin, VEGF directly triggered the tyrosine phosphorylation of focal adhesion kinase and stimulated
PC-3
cell motility. The titration of prostate tissue sections with VEGF-A antibodies revealed a confined staining in chromogranin A and/or serotonin positive neuroendocrine (NE) cells, including in primary tumors and lymph node metastases. Given that NE differentiation is associated with advanced disease, that NE cells are a significant source of VEGF in prostatic tumors, and that VEGF directly act on prostate cancer cells in vitro, VEGF-A may be more than angiogenic in prostate cancer and hence favor progression by affecting tumor cells.
Mol
Cell Endocrinol 2002 Mar 28
PMID:Vascular endothelial growth factor and signaling in the prostate: more than angiogenesis. 1203 75
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>