Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The formation of multinucleated giant cells (MGCs) in an in vivo model of pulmonary inflammation was investigated to determine whether these cells are the result of a dominant T helper (Th) 1 or Th2 cytokine environment. We report that knockout (KO) mice with a disrupted interleukin (IL)-12 p40 gene exposed to the helminth Schistosoma mansoni had abundant and very large MGCs (> 50 microm) in their lungs concurrent with extensive eosinophilia and a population of large macrophages. Many of the MGCs and macrophages appeared to have phagocytosed eosinophils as part of a clearance process. The KO mice also had a strongly polarized Th2 immune response as judged by elevated levels in the lungs of messenger RNA (mRNA) transcripts for IL-4, IL-5, IL-6, and IL-13, but decreased levels of mRNA for interferon-gamma (IFN-gamma) and tumor necrosis factor-alpha (TNF-alpha). In addition, cells recovered by bronchoalveolar lavage from the airways of these mice secreted a Th2-biased profile of cytokines upon restimulation in vitro with parasite antigen. In contrast, wild-type C57BL/6 or KO mice treated with recombinant IL-12 had a polarized Th1 phenotype with elevated levels of IFN-gamma and TNF-alpha mRNA in the lungs, and an airway cell population that secreted abundant IFN-gamma. Very few MGCs were detected in these mice, and there was an absence of pulmonary eosinophilia. We conclude that the formation of MGCs in our model is promoted in the absence of IL-12 and is linked instead to the abundance of Th2 cytokines, notably IL-4 and IL-13.
Am J Respir Cell Mol Biol 1999 Mar
PMID:Formation of multinucleated giant cells in the mouse lung is promoted in the absence of interleukin-12. 1003 Aug 34

Increased concentrations of tumor necrosis factor-alpha (TNF-alpha), interleukin (IL)-4, and IL-13 have been measured in bronchoalveolar lavage fluid (BALF) of patients with asthma following allergen provocation. In addition, these cytokines have also been reported to activate eosinophils in vitro. Although cytokine interactions have been postulated in the activation of eosinophils, the combined effects of cytokines on eosinophil activation remain poorly understood. Because activation of eosinophils has been regarded as a crucial event in the pathogenesis of asthmatic inflammation, we tested the hypothesis that IL-4 and IL-13 could enhance the effects of TNF-alpha on eosinophil activation. For this purpose, eosinophils from normal donors were purified and cultured in the presence of IL-4 or IL-13 and TNF-alpha. Eosinophil survival and surface expression of CD69 were assessed by flow cytometry. There was a concentration- and time-dependent upregulation in CD69 expression as well as eosinophil survival when eosinophils were incubated with IL-13, IL-4, or TNF-alpha. However, eosinophil viability and CD69 expression increased synergistically when eosinophils were incubated with IL-13 or IL-4 in the presence of TNF-alpha. This synergistic effect of IL-4 and IL-13 on CD69 expression was not limited to TNF-alpha but was also observed with IL-5. Our study provides evidence that IL-4 can activate eosinophils in a similar fashion as does IL-13. Furthermore, this study shows that the addition of IL-4 or IL-13 to TNF-alpha or IL-5 has synergistic effects on eosinophil activation, suggesting that the combined effects of different cytokines present in BALF following allergen provocation can enhance eosinophil activation in vitro.
Am J Respir Cell Mol Biol 1999 Mar
PMID:Synergistic effects of interleukin-4 or interleukin-13 and tumor necrosis factor-alpha on eosinophil activation in vitro. 1003 Aug 46

The Th2 cytokine interleukin (IL)-13 is believed to play an important role in the development of allergy, although it has also been ascribed anti-inflammatory roles in several experimental models. In this study, we have examined the effects of human recombinant IL-13 on eosinophilic lung inflammation in the guinea pig. IL-13 (1 to 100 ng, given by intratracheal instillation) did not elicit airway eosinophil recruitment. A pronounced accumulation of eosinophils, as well as monocyte/macrophages, was elicited by intratracheal instillation of guinea pig tumor necrosis factor alpha (gpTNF-alpha). Intratracheal administration of IL-13 (1 to 100 ng) given immediately prior to exposure to gpTNF-alpha resulted in a dose-related suppression of eosinophil and monocyte/macrophage accumulation in the airways, as assessed by bronchoalveolar lavage (BAL) and eosinophil peroxidase activity in whole-lung homogenates. IL-13 treatment also reduced BAL fluid (BALF) leukocyte accumulation induced by subsequent aerosol antigen challenge of sensitized guinea pigs. Antigen challenge also resulted in elevated levels of immunoreactive eotaxin and eosinophil-stimulating activity in BALF, although only the latter was reduced significantly by IL-13 instillation prior to challenge. In contrast to the suppressive effects of IL-13, instillation of human recombinant IL-4 (100 ng) alone elicited an increase in BALF monocyte/macrophage numbers, and IL-4 was unable to inhibit gpTNF-alpha-induced leukocyte accumulation. Hence, IL-13 (but not human IL-4) exhibits an anti-inflammatory action in the airways of gpTNF-alpha- or antigen-challenged guinea pigs, by mechanisms that may involve the decreased generation of eosinophil-stimulating activity in the airways.
Am J Respir Cell Mol Biol 1999 May
PMID:Anti-inflammatory actions of interleukin-13: suppression of tumor necrosis factor-alpha and antigen-induced leukocyte accumulation in the guinea pig lung. 1022 71

We have demonstrated that, in addition to their contractile function, human airway smooth-muscle cells (HASMC) are able to express and to secrete chemokines of the monocyte chemotactic protein (MCP)/ eotaxin subfamily. This group of chemokines is believed to play a fundamental role in the development of allergic airway diseases such as asthma. The expression levels of MCP (MCP-1, -2, and -3) messenger RNA (mRNA) were compared with those of regulated on activation, normal T cells expressed and secreted (RANTES) mRNA in HASMC in culture. HASMC express MCP and RANTES mRNA after stimulation with interleukin (IL)-1beta, tumor necrosis factor-alpha, and interferon-gamma. MCP mRNA was maximal at 8 h, whereas RANTES mRNA expression was delayed to 24 h after stimulation. Further, significant differences were observed in the induction patterns of MCP and RANTES mRNA expression after stimulation with the individual cytokines. Dexamethasone (DEX) significantly inhibited cytokine-induced accumulation of MCP and RANTES mRNA, in contrast to IL-4, IL-10, and IL-13, which had no inhibitory effect on cytokine-induced chemokine expression. The cytokine-induced MCP mRNA expression in HASMC was associated with MCP release, which was inhibited by DEX and post-translationally by IL-4. HASMC can actively participate in the pathogenesis of asthma by the expression and release of chemokines, which are likely to play a critical role in the generation and regulation of the inflammatory response characteristic of allergic airway diseases.
Am J Respir Cell Mol Biol 1999 Oct
PMID:Expression of monocyte chemotactic protein (MCP)-1, MCP-2, and MCP-3 by human airway smooth-muscle cells. Modulation by corticosteroids and T-helper 2 cytokines. 1050 63

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.
Am J Respir Cell Mol Biol 1999 Dec
PMID:Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript. 1057 70

The 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase (3beta-HSD) isoenzymes catalyze an essential step in the formation of all classes of active steroid hormones. We have recently shown that 3beta-HSD type 1 gene expression is specifically induced by interleukin (IL)-4 and IL-13 in breast human cancer cell lines and in normal human mammary epithelial cells in primary culture. There is evidence that IL-4 stimulates bifurcating signaling pathways in which the signal transducer and activator of transcription-6 (Stat6)-signal pathway is involved in differentiation and gene regulation, whereas insulin receptor substrate (IRS) proteins mediate the mitogenic action of IL-4. In fact, we have shown that Stat6 was activated by IL-4 in all cell lines studied where IL-4 induced 3beta-HSD expression, but not in those that failed to respond to IL-4. The present study was designed to investigate the potential contribution of IRS proteins and their downstream targets to IL-4-induced 3beta-HSD type 1 gene expression. IL-4 rapidly induced IRS-1 and IRS-2 phosphorylation in ZR-75-1 human breast cancer cell lines. Moreover, insulin-like growth factor (IGF)-I and insulin, which are well known to cause IRS-1 and IRS-2 phosphorylation, increased the stimulatory effect of IL-4 on 3beta-HSD activity. IRS-1 and IRS-2 are adapter molecules that provide docking sites for different SH2-domain-containing proteins such as the phosphatidylinositol (PI) 3-kinase. In this light, the inhibition of IL-4-induced 3beta-HSD expression by wortmannin and LY294002, two potent PI 3-kinase inhibitors, indicates the probable involvement of the PI 3-kinase signaling molecules in this response to IL-4. Furthermore, it has been suggested that the IRS proteins are part of the signaling complexes that lead to activation of the mitogen-activated protein (MAP) kinase by insulin; thus we investigated the potential role of the MAP kinase (MAPK) cascade in the IL-4 action. In ZR-75-1 cells, both the activation of MAPK by IL-4 and the IL-4-induced 3beta-HSD activity were completely blocked by PD98059, an inhibitor of MAPK activation. Wortmannin also blocked MAPK activation by IL-4, IGF-I, and insulin, suggesting that the MAPK cascade acts as a downstream effector of PI 3-kinases. To further understand the cross-talk between signaling pathways involved in IL-4 action, we investigated the possible involvement of protein kinase C (PKC). The potential role of PKC was suggested by the observation that the well known PKC activator phorbol-12-myristate-13-acetate (PMA) potentiated the IL-4-induced 3beta-HSD activity. Taken together, these findings suggest the existence of a novel mechanism of gene regulation by IL-4. This mechanism would involved the phosphorylation of IRS-1 and IRS-2, which transduce the IL-4 signal through a PI 3-kinase- and MAPK-dependent signaling pathway. The inability of IGF-I, insulin, and PMA to stimulate 3beta-HSD expression by themselves in the absence of IL-4 makes obvious the absolute requirement of an IL-4-specific signaling molecule. Our findings thus suggest that the multiple pathways downstream of IRS-1 and IRS-2 must act in cooperation with the IL-4-specific transcription factor Stat6 to mediate the induction of 31beta-HSD type 1 gene expression in ZR-75-1 human breast cancer cells.
Mol Endocrinol 2000 Feb
PMID:Multiple signaling pathways mediate interleukin-4-induced 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase type 1 gene expression in human breast cancer cells. 1067 96

Airway inflammation, hyperreactivity, increased number of goblet cells, and mucus overproduction characterize asthma. Respiratory challenge with ovalbumin (OVA) of sensitized mice has been shown by several laboratories to cause pulmonary pathology similar to that observed in human allergic asthma. Recently, interleukin (IL)-13 has been shown to be a central mediator in this process. Because the airways of healthy mice have few, if any, mucus-producing cells, an increase in the number of these cells likely reflects induction of mucin-gene expression. The purpose of this study was to identify mucin genes induced as a result of airway goblet-cell metaplasia (GCM) in mice sensitized and challenged with OVA or in mice treated with IL-13 alone. BALB/c mice were sensitized by intraperitoneal injection (Days 0, 4, 7, 11, and 14) and intranasal instillation (Day 14) of 100 microg of OVA in saline, and then challenged by intranasal instillation (Days 25, 26, and 27) of the same. IL-13-treated mice received 5 microg of IL-13 by intranasal instillation on three consecutive days. Control mice were given saline alone. All mice were studied 24 h after the last challenge. Histologic analysis of the lungs revealed both a striking peribronchial and perivascular lymphocytic and eosinophilic inflammation and airway GCM in OVA-treated mice, and also airway GCM without inflammation in IL-13-treated mice. Northern blot analysis of lung RNA demonstrated (1) expression of Muc-5/5ac messenger RNA (mRNA) in OVA-treated and IL-13-treated mice, but not in control mice; (2) expression of Muc-1 mRNA at comparable levels in all mice regardless of treatment; and (3) no expression of Muc-2 or Muc-3 mRNA in control or treated mice. Western blot analysis demonstrated the expression of Muc-5/5ac protein (both apomucin and glycosylated mucin) in lung lysates of OVA-treated (but not control) mice, and also the expression of Muc-5/5ac mucins in the bronchoalveolar lavage fluid of OVA-treated and IL-13-treated mice. These findings demonstrate that airway GCM is associated with the induction of pulmonary expression of Muc-5/5ac mRNA and mucin in murine models of allergic asthma.
Am J Respir Cell Mol Biol 2000 Mar
PMID:Muc-5/5ac mucin messenger RNA and protein expression is a marker of goblet cell metaplasia in murine airways. 1069 60

Asthma and atopy show epidemiological association and are biologically linked by T-helper type 2 (T(h)2) cytokine-driven inflammatory mechanisms. IL-4 operates through the IL-4 receptor (IL-4R, a heterodimer of IL-4Ralpha and either gammac or IL-13Ralpha1) and IL-13 operates through IL-13R (a heterodimer of IL-4Ralpha and IL-13Ralpha1) to promote IgE synthesis and IgE-based mucosal inflammation which typify atopy. Recent animal model data suggest that IL-13 is a central cytokine in promoting asthma, through the stimulation of bronchial epithelial mucus secretion and smooth muscle hyper-reactivity. We investigated the role of common genetic variants of IL-13 and IL-13Ralpha1 in human asthma, considering IgE levels. A novel variant of human IL-13, Gln110Arg, on chromosome 5q31, associated with asthma rather than IgE levels in case-control populations from Britain and Japan [peak odds ratio (OR) = 2.31, 95% CI 1.33-4.00]; the variant also predicted asthma and higher serum IL-13 levels in a general, Japanese paediatric population. Immunohistochemistry demonstrated that both subunits of IL-13R are prominently expressed in bronchial epithelium and smooth muscle from asthmatic subjects. Detailed molecular modelling analyses indicate that residue 110 of IL-13, the site of the charge-modifying variants Arg and Gln, is important in the internal constitution of the ligand and crucial in ligand-receptor interaction. A non-coding variant of IL-13Ralpha1, A1398G, on chromosome Xq13, associated primarily with high IgE levels (OR = 3. 38 in males, 1.10 in females) rather than asthma. Thus, certain variants of IL-13 signalling are likely to be important promoters of human asthma; detailed functional analysis of their actions is needed.
Hum Mol Genet 2000 Mar 01
PMID:Genetic variants of IL-13 signalling and human asthma and atopy. 1069 78

We investigated keratinocyte growth factor (KGF) as a pretreatment therapy for idiopathic pneumonia syndrome (IPS) generated as a result of lung damage and allogeneic T cell-dependent inflammatory events occurring in the early peri-bone marrow (BM) transplant (BMT) period. B10.BR (H2(k)) recipient mice were transplanted with C57BL/6 (H2(b)) BM with spleen cells after lethal irradiation with and without cyclophosphamide conditioning with and without subcutaneous KGF pretreatment. KGF-pretreated mice had fewer injured alveolar type II (ATII) cells at the time of BMT and exhibited ATII cell hyperplasia at day 3 post-BMT. The composition of infiltrating cells on day 7 post-BMT was not altered by KGF pretreatment, but the frequencies of cells expressing the T-cell costimulatory molecules B7.1 and B7.2 and mRNA for the cytolysin granzyme B (usually increased in IPS) were decreased by KGF. Sera from KGF-treated mice had increases in the Th2 cytokines interleukin (IL)-4, IL-6, and IL-13 4 days after cessation of KGF administration (i.e., at the time of BMT). These data suggest that KGF hinders IPS by two modes: 1) stimulation of alveolar epithelialization and 2) attenuation of immune-mediated injury as a consequence of failure to upregulate cytolytic molecules and B7 ligand expression and the induction of anti-inflammatory Th2 cytokines in situ.
Am J Physiol Lung Cell Mol Physiol 2000 May
PMID:KGF pretreatment decreases B7 and granzyme B expression and hastens repair in lungs of mice after allogeneic BMT. 1078 30

Interleukin (IL)-1beta stimulates the release of granulocyte macrophage colony-stimulating factor (GM-CSF) from lung epithelial cells. To investigate the molecular mechanisms underlying GM-CSF regulation, we studied GM-CSF production, messenger RNA (mRNA) expression levels, and GM-CSF promoter activity in A549 human alveolar carcinoma cells stimulated with IL-1beta. Coincubation with IL-4 or IL-13 dose-dependently inhibited IL-1beta-induced GM-CSF release. Time-course studies of intracellular and extracellular protein release and mRNA expression indicated tight coupling of protein and mRNA synthesis within 6 h after stimulation. IL-4 and IL-13 both inhibited expression of GM-CSF mRNA and protein by 2 h after stimulation. Stable transfection of A549 cells, with GM-CSF promoter/ enhancer constructs containing up to 3.3 kb upstream of the transcription start site, revealed maximal activation by IL-1beta and phorbol 12-myristate 13-acetate (PMA) with a reporter containing the proximal promoter (-627 to +35). This excludes sequences further upstream from a major regulatory role in GM-CSF promoter activation by IL-1beta or PMA in these cells. IL-4 and IL-13 downregulated promoter activation but had no effect on GM-CSF mRNA half-life. However, IL-1beta activation of all constructs was far less pronounced than in Jurkat T cells, suggesting a requirement for additional mechanisms, possibly post-transcriptional, to potentiate the observed transcriptional induction.
Am J Respir Cell Mol Biol 2000 May
PMID:Molecular regulation of granulocyte macrophage colony-stimulating factor in human lung epithelial cells by interleukin (IL)-1beta, IL-4, and IL-13 involves both transcriptional and post-transcriptional mechanisms. 1078 30


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>