Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have identified two novel chromosomal proteins from Physarum polycephalum using a protein blotting DNA-binding assay. A fraction of these proteins was readily released from nuclei by solutions of moderate ionic strength (0.15 N-0.35 M NaCl) or mild nuclease treatment and appear associated with chromatin that is nucleosome-free. A significant proportion of these proteins, however, was not released from nuclei by solutions of high ionic strength (1.6 M NaCl) or treatment with excess nuclease. These results suggest that these chromosomal proteins are distributed between transcriptionally-competent and inert domains of chromatin. Both proteins preferentially and tenaciously bound duplex DNA, especially to the alternating B-DNA conformation displayed by the synthetic sequence, poly d(A-T).poly d(A-T).
Mol Biol Rep 1992 May
PMID:Chromosomal proteins of Physarum polycephalum with preferential affinity for the sequence, poly d(A-T).poly d(A-T). 160 98

Accessible surface areas of DNA molecules (A- and B-forms) for different probe particle radii were calculated for poly(dA).poly(dT) and poly[d(A-T)].poly[d(A-T)] sequences. The problem of different forms stability is discussed in connection with accessible surface area characteristics as well as coulombic interaction between base pairs. The coulombic interaction was shown to play an important role in sequence dependent stability of the DNA molecule.
Mol Biol (Mosk)
PMID:[Accessibility for water molecules and relative stability of the A- and B-forms of DNA]. 189 32

Two-dimensional nuclear Overhauser effect (2D NOE) spectra have been used as the experimental basis for determining the solution structure of the duplex [d(GTATATAC)]2 employing restrained molecular dynamics (rMD) simulations. The MARDIGRAS algorithm has been employed to construct a set of 233 interproton distance constraints via iterative complete relaxation matrix analysis utilizing the peak intensities from the 2D NOE spectra obtained for different mixing times and model structures. The upper and lower bounds for each of the constraints, defining size of a flat-well potential function term used in the rMD simulations, were conservatively chosen as the largest or smallest value calculated by MARDIGRAS. Three different starting models were utilized in several rMD calculations: energy-minimized A-DNA, B-DNA, and a structure containing wrinkled D-DNA in the interior. Considerable effort was made to define the appropriate force constants to be employed with the NOE terms in the AMBER force field, using as criteria the average constraints deviation, the constraints violation energy and the total energy. Of the 233 constraints, one was generated indirectly, but proved to be crucial in defining the structure: the cross-strand A5-H2 A5-H2 distance. As those two protons resonate isochronously for the self-complementary duplex, the distance cannot be determined directly. However, the general pattern of 2D NOE peak intensities, spin-lattice relaxation time (T1) values, and 31P nuclear magnetic resonance spectra lead to use of the A3-H2 A7-H2 distance for A5-H2 A5-H2 as well. Five rMD runs, with different random number seeds, were made for each of the three starting structures with the full distance constraint set. The average structure from all 15 runs and the five-structure averages from each starting structure were all quite similar. Two rMD runs for each starting structure were made with the A5-H2 A5-H2 constraint missing. The average of these six rMD runs revealed differences in structure, compared to that with the full set of constraints, primarily for the middle two base-pairs involving the missing cross-strand constraint but global deviations also were found. Conformational analysis of the resulting structures revealed that the inner four to six base-pairs differed in structure from the termini. Furthermore, an alternating structure was suggested with features alternating for the A-T and T-A steps.
J Mol Biol 1991 Sep 05
PMID:Solution structure of [d(GTATATAC)]2 via restrained molecular dynamics simulations with nuclear magnetic resonance constraints derived from relaxation matrix analysis of two-dimensional nuclear Overhauser effect experiments. 192 Apr 10

The crystal structure of the DNA decamer C-C-A-A-C-G-T-T-G-G has been solved to a resolution of 1.4 A, and is compared with the 1.3 A structure of C-C-A-A-G-A-T-T-G-G and the 1.6 A structure of C-C-A-G-G-C-C-T-G-G. All three decamers crystallize isomorphously in space group C2 with five base-pairs per asymmetric unit, and with decamer double helices stacked atop one another along the c axis in a manner that closely approximates a continuous B helix. This efficient stacking probably accounts for the high resolution of the crystal data. Comparison of the three decamers reveals the following. (1) Minor groove width is more variable than heretofore realized. Regions of A.T base-pairs tend to be narrower than average, although two successive A.T base-pairs alone may not be sufficient to produce narrowing. The minor groove is wider in regions where BII phosphate conformations are opposed diagonally across the groove. (2) Narrow regions of minor groove exhibit a zig-zag spine of hydration, as was first seen in C-G-C-G-A-A-T-T-C-G-C-G, whereas wide regions show two ribbons of water molecules down the walls, connecting base edge N or O with sugar O-4' atoms. Regions of intermediate groove width may accommodate neither pattern of hydration well, and may exhibit a less regular pattern of hydration. (3) Base-pair stacking is virtually identical at equivalent positions in the three decamers. The unconnected step from the top of one decamer helix to the bottom of the next helix is a normal helix step in all respects, except for the absence of connecting phosphate groups. (4) BII phosphate conformation require the unstacking of the two bases linked by the phosphate, but do not necessarily follow as an inevitable consequence of unstacking. They have an influence on minor groove width as noted in point (1) above. (5) Sugar ring pseudorotation P and main-chain torsion angle delta show an excellent correlation as given by the equation: delta = 40 degrees cos (P + 144 degrees) + 120 degrees. Although centered around C-2'-endo, the conformations in these B-DNA helices are distributed broadly from C-3'-exo to O-4'-endo, unlike the tighter clustering around C-3'-endo observed in A-DNA oligomer structures.
J Mol Biol 1991 Jan 05
PMID:Structure of the B-DNA decamer C-C-A-A-C-G-T-T-G-G and comparison with isomorphous decamers C-C-A-A-G-A-T-T-G-G and C-C-A-G-G-C-C-T-G-G. 198 77

Local variations in B-DNA helix structure are compared among three decamers and eight dodecamers, which contain examples of all ten base-pair step types. All pairwise combinations of helix parameters are compared by linear regression analysis, in a search for internal relationships as well as correlations with base sequence. The primary conclusions are: (1) Three-center hydrogen bonds between base-pairs occur frequently in the major groove at C-C, C-A, A-A and A-C steps, but are less convincing at C-C and C-T steps in the minor groove. The requirements for large base-pair propeller are (1) that the base-pair should be A.T rather than G.C, and (2) that it be involved in a major groove three-center hydrogen bond with the following base-pair. Either condition alone is insufficient. Hence, a large propeller is expected at the leading base-pair of A-A and A-C steps, but not at A-T, T-A, C-A or C-C steps. (2) A systematic and quantitative linkage exists between helix variables twist, rise, cup and roll, of such strength that the rise between base-pairs can hardly be described as an independent variable at all. Two typical patterns of behavior are observed at steps from one base-pair to the next: high twist profile (HTP), characterized by high twist, low rise, positive cup and negative roll, and low twist profile (LTP), marked by low twist, high rise; negative cup and positive roll. Examples of HTP are steps G-C, G-A and Y-C-A-R, where Y is pyrimidine and R is purine. Examples of LTP steps are C-G, G-G, A-G and C-A steps other than Y-C-A-R. (3) The minor groove is especially narrow across the two base-pairs of the following steps: A-T, T-A, A-A and G-A. (4) In general, base step geometry cannot be correlated solely with the bases that define the step in question; the two flanking steps also must be taken into account. Hence, local helix structure must be studied in the context, not of two base-pairs: A-B, but of four: x-A-B-y. Calladine's rules, although too simple in detail, were correct in defining the length of sequence over which a given perturbation is expressed. Whereas ten different two-base steps are possible, allowing for the identity of complementary sequences, there are 136 different four-base steps. Only 33 of these 136 four-base steps are represented in the decamer and dodecamer structures solved to date, and hence it is premature to try to set up detailed structural algorithms. (5) The sugar-phosphate backbone chains of B-DNA place strong limits on sequence-induced structural variation, damping down most variables within four or five base-pairs, and preventing purine-purine anti-anti mismatches from causing bulges in the double helix. Hence, although short-range sequence-induced deformations (or deformability) are observed, long-range deformations propagated down the helix are not to be expected.
J Mol Biol 1991 Jan 05
PMID:Analysis of local helix geometry in three B-DNA decamers and eight dodecamers. 198 78

The conformation of the self-complementary B-DNA decamer C-C-A-A-C-G-T-T-G-G is known from a high-resolution x-ray crystal structure analysis. Molecular dynamics simulation of the hydration shell of the decamer has revealed two main types of minor-groove hydration, depending on groove width. The narrow part of the minor groove has a spine of hydration analogous to that described for the A + T-rich center of the minor groove in the dodecamer C-G-C-G-A-A-T-T-C-G-C-G [Drew, H. R. & Dickerson, R. E. (1981) J. Mol. Biol. 151, 535-556], the first hydration layer of which contains one water molecular per base pair. In contrast, in the wide part of the minor groove, each base is hydrated individually, water molecules lying predominantly in the base plane. In intermediate-width regions, preferred water-molecule sites are shifted away from the base plane in a 3'-to-5' direction. This shift becomes more pronounced as the minor groove narrows, until the two water molecules lie approximately midway between base pairs. If the minor groove is narrowed still further, it accommodates only one water molecule, and the hydration transforms to the well-known water spine. The observed pattern agrees with available crystallographic data and with our earlier calculations. The results confirm the assumption that preferred positions of water oxygens in the minor groove depend predominantly on groove width rather than on base sequence. However, the location of water hydrogens, and the network of hydrogen bonding, can depend on base sequence. We suggest a simple explanation of water-spine formation in the narrow minor groove of a random DNA sequence. The spine of hydration may be a property of the minor groove of overwound variants of B-DNA, the C and D forms, for which the middle part of the decamer C-C-A-A-C-G-T-T-G-G can serve as a model.
 ...
PMID:Molecular dynamics simulation of the hydration shell of a B-DNA decamer reveals two main types of minor-groove hydration depending on groove width. 198 54

The Escherichia coli cytR-encoded repressor protein (CytR) controls the expression of several genes involved in nucleoside and deoxynucleoside uptake and metabolism. The cytR promoter was identified by determining the transcriptional initiation site of the cytR gene. A chromosomal cytR-lacZ+ operon fusion was isolated and used to study the regulation of cytR. We show that cytR expression is negatively controlled by the CytR protein and positively affected by the cAMP/CAP complex. Footprinting studies with purified CAP protein revealed two CAP binding sites upstream of the cytR promoter. A previously described mutation (cytR*) in the cloned cytR gene, which results in the phenotypic suppression of a CytR operator mutation in the tsx P2 promoter, was analysed. DNA sequence analysis of the cytR* mutation revealed a G-C to an A-T base pair transition at position -34 bp relative to the translational initiation site of cytR. This point mutation activates a cryptic promoter that is stronger than the wild-type cytR promoter and leads to overproduction of the CytR repressor.
Mol Microbiol 1990 Mar
PMID:Transcriptional regulation of the cytR repressor gene of Escherichia coli: autoregulation and positive control by the cAMP/CAP complex. 216 67

A HeLa DNA fragment, which may function as an anchorage point to the nuclear matrix for human chromosomes 1 and 2, also functions as an autonomously replicating sequence (ARS) in the yeast Saccharomyces cerevisiae. In the present report we show that this DNA fragment contains both bent DNA and an A-T rich region which appear to be associated with the ARS function. More interestingly, DNA sequence analysis shows that the spatial distribution of these features is strikingly similar to that found in the yeast ARS1 element.
Mol Gen Genet 1990 Feb
PMID:An autonomously replicating sequence from HeLa DNA shows a similar organization to the yeast ARS1 element. 218 51

The solution structures of two alternating purine-pyrimidine octamers, [d(G-T-A-C-G-T-A-C)]2 and the reverse sequence [d(C-A-T-G-C-A-T-G)]2, are investigated by using nuclear magnetic resonance spectroscopy and restrained molecular dynamics calculations. Chemical shift assignments are obtained for non-exchangeable protons by a combination of two-dimensional correlation and nuclear Overhauser enhancement (NOE) spectroscopy experiments. Distances between protons are estimated by extrapolating distances derived from time-dependent NOE measurements to zero mixing time. Approximate dihedral angles are determined within the deoxyribose ring from coupling constants observed in one and two-dimensional spectra. Sets of distance and dihedral determinations for each of the duplexes form the bases for structure determination. Molecular dynamics is then used to generate structures that satisfy the experimental restraints incorporated as effective potentials into the total energy. Separate runs start from classical A and B-form DNA and converge to essentially identical structures. To circumvent the problems of spin diffusion and differential motion associated with distance measurements within molecules, models are improved by NOE-based refinement in which observed NOE intensities are compared to those calculated using a full matrix analysis procedure. The refined structures generally have the global features of B-type DNA. Some, but not all, variations in dihedral angles and in the spatial relationships of adjacent base-pairs are observed to be in synchrony with the alternating purine-pyrimidine sequence.
J Mol Biol 1990 Oct 05
PMID:Solution conformation of purine-pyrimidine DNA octamers using nuclear magnetic resonance, restrained molecular dynamics and NOE-based refinement. 223 13

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
J Mol Biol 1990 Jan 05
PMID:Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. 229 70


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>