Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The salivary gland cells in the dipteran Chironomus tentans produce approximately 15 different secretory proteins, with relative molecular masses ranging between 1 x 10(4) and 1 x 10(6). Together these proteins form two types of extra corporal tubes, a larval protective housing and feeding tube or a pupation tube. The developmental change in tube formation is accompanied by a switch in production from one combination of secretory proteins to another. Here we characterize two genes, the sp38-40.A and B genes, which encode secretory proteins with relative molecular masses of 38,000 to 40,000. The two genes are located 346 base-pairs apart in the same orientation and have presumably arisen by gene duplication as the result of an illegitimate recombination event. Both genes contain two regions with cysteine codons, surrounded by regions with short repeats coding for proline and charged amino acid residues. The two genes and alleles of the genes differ in their number of repeats. This structure resembles the structure of the Balbiani ring (BR) genes, which encode the four largest salivary gland secretory proteins. The sp38-40.A and B genes are therefore likely to belong to a BR multigene family containing all or most of the 15 salivary gland
secretory protein
genes. The expression of the sp38-40.A and B genes are different: the A gene is expressed throughout the larval fourth instar but considerably less in the prepupal stage, while the B gene shows the opposite expression pattern. The developmental regulation of the expression of the two genes has therefore diverged after the gene duplication event.
J
Mol
Biol 1993 May 20
PMID:Two secretory protein genes in Chironomus tentans have arisen by gene duplication and exhibit different developmental expression patterns. 851 Jan 50
Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major
secretory protein
of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human endometrial adenocarcinoma cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59-bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis-elements.(ABSTRACT TRUNCATED AT 250 WORDS)
Mol
Endocrinol 1995 Oct
PMID:Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line. 854 48
The adaptation and application of the Escherichia coli T7 RNA polymerase system for regulated and promoter-specific gene expression in Bacillus subtilis is reported. The expression cassette used in Bacillus subtilis was tightly regulated and T7 RnA polymerase (T7 RNAP)appeared 30 minutes after induction. The efficiency of T7 promoter-specific gene expression in B.subtilis was studied using one secretory and two cytosolic proteins of heterologous origin. The accumulation of E. coli beta-galactosidase, as well as a 1,4-beta-glucosidase from Thermoanaerobacter brockii in B. subtilis after T7 RNAP induction was strongly enhanced by rifampicin inhibition of host RNAP activity. The alpha-amylase of Thermactinomyces vulgaris, a
secretory protein
, was found to accumulate in the culture supernatant up to levels of about 70 mg/l 10-20 h after T7 RNAP induction, but was also deposited in cellular fractions. The addition of rifampicin inhibited chi-amylase secretion, but unexpectedly, after a short period, also prevented its further (intra)cellular accumulation.
Mol
Gen Genet 1996 Feb 05
PMID:A T7 promoter-specific, inducible protein expression system for Bacillus subtilis. 862 23
The GNOM gene is required for pattern formation along the main body axis of the embryo in the flowering plant Arabidopsis thaliana. Mutations in the GNOM gene alter the asymmetric division of the zygote and interfere with the formation of distinct apical-basal regions in the developing embryo. We have isolated the GNOM gene by positional cloning, characterised its structure and determined the molecular lesions in mutant alleles. Although the predicted 163 kDa GNOM protein has a conserved domain in common with the yeast
secretory protein
Sec7p, it is most closely related in size and overall similarity to the product of the yeast YEC2 gene, which is not essential for cell viability. Four fully complementing gnom alleles carry missense mutations in conserved regions, seven partially complementing alleles have premature stop codon mutations and two non-complementing alleles have splice-site lesions. Our results suggest that the GNOM protein acts as a complex of identical subunits and that partial complementation may involve low levels of full-length protein generated by inefficient translational read-through.
Mol
Gen Genet 1996 Apr 10
PMID:Molecular analysis of the Arabidopsis pattern formation of gene GNOM: gene structure and intragenic complementation. 862 28
Nonciliated bronchiolar epithelial (Clara) cells, as both the primary target for metabolically activated pulmonary cytotoxicants and the progenitor during repair after bronchiolar injury, are critical for distal airway epithelial function and regeneration. The role of Clara cells in normal lung function is poorly understood partly because their abundance, sensitivity to cytotoxicants, and expression of differentiation markers vary by airway level and species. This study defines a strategy for maintenance in vitro of differentiated Clara cells within their local microenvironment. Lungs from adult mice were infalted with 1% agarose and distal airways were isolated by microdissection. Explants were cultured for 7 days in serum-free medium. Preservation of Clara cell morphology after 7 days in culture (DIC) was demonstrated using light and electron microscopy. Ciliated cells were also present. Cytochrome P450 monooxygenase activity, as measured by naphthalene epoxidation, was decreased 50% between 0 and 7 DIC, but the apparent stereoselectivity of metabolism was unchanged at 7 days. Marker proteins for differentiated Clara cells (
secretory protein
, CYP2F2 and CYP2B4) were detectable immunochemically throughout time in culture. Glutathione S-transferase activity and levels of reduced glutathione were unchanged over 7 DIC. We conclude that differentiated Clara cells can be maintained in cultures of explants from defined airway regions. Bronchiolar epithelial cells in this system are viable, synthesize and secrete
secretory protein
, metabolize xenobiotics via the cytochrome P450 system, have a stable phase II enzyme system, and maintain glutathione pools.
Am J Respir Cell
Mol
Biol 1996 Jun
PMID:Maintenance of differentiated murine Clara cells in microdissected airway cultures. 865 87
Acute-phase reactants (APRs) are proteins synthesized in the liver following induction by interleukin-1 (IL-1), IL-6, and glucocorticoids, involving transcriptional gene activation. Lipopolysaccharide-binding protein (LBP) is a recently identified hepatic
secretory protein
potentially involved in the pathogenesis of sepsis, capable of binding the bacterial cell wall product endotoxin and directing it to its cellular receptor, CD14. In order to examine the transcriptional induction mechanisms by which the LBP gene is activated, we have investigated the regulation of expression of its mRNA in vitro and in vivo as well as the organization of 5' upstream regulatory DNA sequences. We show that induction of LBP expression is transcriptionally regulated and is dependent on stimulation with IL-1beta, IL-6, and dexamethasone. By definition, LBP thus has to be viewed as a class 1 acute-phase protein and represents the first APR identified which is capable of detecting pathogenic bacteria. Furthermore, cloning of the LBP promoter revealed the presence of regulatory elements, including the common APR promoter motif APRE/STAT-3 (acute-phase response element/signal transducer and activator of transcription 3). Luciferase reporter gene assays utilizing LBP promoter truncation and point mutation variants indicated that transcriptional activation of the LBP gene required a functional APRE/STAT-3 binding site downstream of the transcription start site, as well as an AP-1 and a C/EBP (CCAAT enhancer-binding protein) binding site. Gel retardation and supershift assays confirmed that upon cytokine stimulation APRF/STAT-3 binds to its recognition site, leading to strong activation of the LBP gene. Unraveling of the mechanism of transcriptional activation of the LBP gene, involving three known transcription factors, may contribute to our understanding of the acute-phase response and the pathophysiology of sepsis and septic shock.
Mol
Cell Biol 1996 Jul
PMID:The lipopolysaccharide-binding protein is a secretory class 1 acute-phase protein whose gene is transcriptionally activated by APRF/STAT/3 and other cytokine-inducible nuclear proteins. 866 65
Nonciliated bronchiolar epithelial (Clara) cells, as both the primary target for metabolically activated pulmonary toxicants and the progenitor cell for repair after bronchiolar injury, are critical for distal airway epithelial function and regeneration. Previously, we described a model system whereby differentiated Clara cells can be maintained in culture using explants of microdissected distal airways. The purpose of this study is to establish whether distal airway explants can be used to study bronchiolar epithelial repair in vitro. Lungs from adult mice treated with naphthalene, a metabolically activated Clara cell cytotoxicant, or vehicle were inflated with agarose and distal airways were microdissected. Distal airway explants were cultured for up to 7 days in serum-free medium. Clara cells in explants from naphthalene-treated mice exhibited the characteristic cytotoxic responses previously reported in vivo when maintained in vitro: cell swelling, formation of cytoplasmic vacuoles, and exfoliation of injured cells into the airway lumen 1 to 2 days after injury (DAI). Epithelial cells squamated to cover the injured area 2 to 4 DAI. At 7 DAI, the epithelium generally consisted of cuboidal cells. Proliferating cells and marker proteins for differentiated Clara cells (Clara cell 10 kD
secretory protein
, or CC10, and cytochrome P450 monooxygenase isozyme 2B, or CYP2B) were detected immunochemically and their pattern of distribution during the injury and repair response in vitro paralleled the pattern of cell regeneration seen previously in vivo. We conclude that Clara cells in explants from defined regions of murine tracheobronchial airways can be used to study the early phases of the repair response to naphthalene injury, including differentiation and proliferation, in vitro.
Am J Respir Cell
Mol
Biol 1996 Jul
PMID:Repair of naphthalene-injured microdissected airways in vitro. 867 13
The gene encoding MSVSP99 (mouse seminal vesicle
secretory protein
of 99 amino acids), an androgen-dependent protein specifically expressed in the mouse seminal vesicle, was isolated and sequenced. A mouse genomic library constructed in the lambda EMBL12 vector was screened using a full length cDNA probe. One genomic clone was selected, 7.4 kb of which were shown to contain the whole MSVSP99 gene. The complete sequence of the MSVSP99 gene (1.7 kb), plus 0.8 and 0.3 kb of the 5' and 3' flanking regions respectively, has been determined. The gene is composed of four exons interrupted by three introns. The size range for the four exons is 47-217 bp, while that of introns is 87-615 bp. The transcription start site was identified as an adenine residue located 21 nucleotides upstream from the ATG start codon. Putative TATA and CAAT boxes were identified, along with a number of regions that shared homologies with known regulatory sequences. These included androgen-responsive elements located in the promoter as well as in the gene sequence. Sequence comparisons with other androgen-responsive genes showed strong homologies between the MSVSP99 gene and the seminal vesicle
secretory protein
(SVS) family genes (rat SVS II, IV, V and VI). Moreover, some regions were found to be conserved between the MSVSP99 gene and the human semenogelin I and II genes.
J
Mol
Endocrinol 1995 Dec
PMID:Structure and sequence of a mouse gene encoding an androgen-regulated protein: a new member of the seminal vesicle secretory protein family. 874 37
P-domain peptides, a new family of secretory polypeptides, have been identified mainly in the gastroenteropancreatic tract of humans, rodents, and amphibians as well as in amphibian skin. In the present study, with PCR and RNA analysis a transcript has been discovered in rat brain termed rP1.B. The deduced polypeptide consists of a single P-domain and its amino acid sequence matches that of rat
intestinal trefoil factor
(rITF). Thus far, rP1.B is the only P-domain peptide expressed in neuronal cells of the CNS. Immunostained magnocellular perikarya were visible in the paraventricular, supraoptic and periventricular nuclei. Parvocellular rP1.B neurons were found in the arcuate nucleus. Additionally, specific hybridization signals with radiolabeled transcripts were observed in the same regions. rP1.B in the rat hypothalamus may be involved in the control of hypothalamo-hypophysial functions.
Brain Res
Mol
Brain Res 1995 Nov
PMID:Molecular and cellular analysis of rP1.B in the rat hypothalamus: in situ hybridization and immunohistochemistry of a new P-domain neuropeptide. 875 Aug 86
A mutant of Listeria monocytogenes EGD was constructed that carries an extended deletion removing the entire PrfA-regulated gene cluster from plcA to plcB and a second deletion inactivating the inlA gene. Upon supplementation of this mutant with multiple gene copies of prfA, a protein of 30 kDa was detected in the supernatant of the mutant strain. The gene encoding this protein was obtained by direct and inverse polymerase chain reaction using oligonucleotide primers that were deduced from partial amino acid sequences of the purified 30 kDa protein. The amino acid sequence of the gene product revealed a protein of 297 amino acids that carried eight repeat units with high homology to those of the two known internalin proteins A and B. This
secretory protein
, termed internalin C, is much smaller than InlA or InlB and its complete sequence is related to the two known internalins. The gene InlC is transcribed into a monocistronic mRNA from a single promoter which shows a typical consensus sequence for PrfA-binding at the position -40. In contrast to the transcription of the InlAB operon, which is downregulated after shift of an L. monocytogenes EGD culture from brain-heart infusion into minimum essential medium (MEM), transcription of inlC is induced in MEM like most of the other known PrfA-regulated virulence genes. In addition, InlC is strongly transcribed in the cytoplasm of phagocytic J774 cells whereas inlA is poorly transcribed under these conditions, suggesting that internalin C may play a role in a late stage of L. monocytogenes infection rather than in the uptake of L. monocytogenes by non-professional phagocytic cells. An InlC deletion mutant shows reduced virulence when tested in an intravenous mouse model, but intracellular replication of the mutant in Caco-2 and J774 cells appears to be comparable with that of the wild-type strain.
Mol
Microbiol 1996 Aug
PMID:A new PrfA-regulated gene of Listeria monocytogenes encoding a small, secreted protein which belongs to the family of internalins. 887 44
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>