Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The permeability of bacterial outer membranes was assayed by coupling the influx of highly hydrophobic probes, 3-oxosteroids, with their subsequent oxidation catalysed by 3-oxosteroid delta 1-dehydrogenase, expressed from a gene cloned from Pseudomonas testosteroni. In Salmonella typhimurium producing wild-type lipopolysaccharide, the permeability coefficients for uncharged steroids were 0.45 to 1 x 10(-5) cm s-1, and the diffusion appeared to occur mainly through the lipid bilayer domains of the outer membrane. These rates are one or two magnitudes lower than that expected for their diffusion through the usual biological membranes. The permeation rates were markedly increased (up to 100 times) when the lipopolysaccharide leaflet was perturbed either by adding deacylpolymyxin or by introducing mutations leading to the production of deep rough lipopolysaccharides. An amphiphilic, negatively charged probe, testosterone hemisuccinate, penetrated much more slowly than the uncharged steroids. Study of various Gram-negative species revealed that P. testosteroni, Pseudomonas acidovorans, and Acinetobacter calcoaceticus showed higher outer membrane permeability to steroid probes and higher susceptibility to hydrophobic agents such as fusidic acid, novobiocin and crystal violet relative to S. typhimurium and Escherichia coli.
Mol Microbiol 1992 May
PMID:Outer membranes of gram-negative bacteria are permeable to steroid probes. 164 Aug 33

The active metabolite of vitamin D, 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3], is a potent regulator of human monocyte/macrophage function in vitro. To establish a model for 1,25-(OH)2D3 regulation of human monocyte monokine synthesis, three human cell lines (U-937, THP-1, and HL-60) were examined for: 1) the presence of functional 1,25-(OH)2D3 receptors; 2) the accumulation of interleukin-1 beta (IL-1 beta) mRNA and IL-1 beta protein in response to lipopolysaccharide (LPS); and 3) the regulation of this response by 1,25-(OH)2D3. All three cell lines expressed vitamin D receptor and had increased levels of IL-1 beta mRNA in response to LPS. Preincubation of cells with 1,25-(OH)2D3 augmented IL-1 beta mRNA levels only in U-937 and HL-60 cells. From these data, and taking into consideration their state of differentiation and relative ease of culture, U-937 was chosen over HL-60 and THP-1 as the cell line we further characterized. In U-937 cells, optimum time and dose of pretreatment with 1,25-(OH)2D3 were determined to be 12-24 h at a receptor saturating concentration of 1,25-(OH)2D3 (10 nM). Preincubation of cells with 1,25-(OH)2D3 had no effect on the time course of IL-1 beta mRNA appearance in response to LPS. However, exposure of U-937 cells to 1,25-(OH)2D3 increased by 200% the level of IL-1 beta mRNA detected and decreased by three orders of magnitude the concentration of LPS required to achieve steady state mRNA levels equivalent to those observed in U-937 cells not preincubated with the hormone.2+o
Mol Endocrinol 1991 Feb
PMID:The human myelomonocytic cell line U-937 as a model for studying alterations in steroid-induced monokine gene expression: marked enhancement of lipopolysaccharide-stimulated interleukin-1 beta messenger RNA levels by 1,25-dihydroxyvitamin D3. 164 52

The insulin-like growth factor (IGF)-II/mannose-6-phosphate (M6P) receptor, which targets acid hydrolases to lysosomes, is a multifunctional protein with separate binding sites for IGF-II and M6P. The purpose of this study was to determine if alveolar macrophages (AM) and their precursor cells, blood monocytes, expressed this receptor. AM expressed IGF-II/M6P receptors as detected by [125]IGF-II surface binding that was not reduced by recombinant IGF-I or IGF-I receptor monoclonal antibody (alpha IR3). Surface binding was also detected on blood monocytes and could be upregulated approximately 4-fold by incubation with lipopolysaccharide. There were no differences in surface binding by AM lavaged from individuals with asbestos exposure or from normal volunteers. Using the polymerase chain reaction and reverse transcriptase to reverse-transcribe mRNA from mononuclear phagocytes, specific IGF-II/M6P receptor cDNA was amplified and detected by agarose gel electrophoresis from both AM and blood monocytes. The IGF-II/M6P receptor has an intracellular transport role in many cells cycling from the cell surface to the cytoplasm, or binding to phosphorylated acid hydrolases in the Golgi and transporting them to an acidic prelysosomal site where they dissociate and fuse to the lysosomes and IGF-II/M6P recycles to the trans-Golgi. These functions may be particularly important in asbestosis and other interstitial lung diseases where AM are activated, intracellular lysosomes are a prominent morphologic feature, and acid hydrolases are found in recovered lavage fluid.
Am J Respir Cell Mol Biol 1991 Jun
PMID:Human mononuclear phagocytes express the insulin-like growth factor-II/mannose-6-phosphate receptor. 164 80

To establish the molecular basis of the chromosomal virulence genes of Shigella flexneri 2a (YSH6000), a Notl restriction map of the chromosome was constructed by exploiting Notl-linking clones, partial Notl digestion and DNA probes from various genes of Escherichia coli K-12. The map revealed at least three local differences in the placements of genes between YSH6000 and E. coli K-12. Using the additional Notl sites introduced by Tn5 insertion, nine virulence loci identified previously by random Tn5 insertions were physically mapped on the chromosome. To demonstrate the versatility of the Notl map in direct assignment of the virulence loci tagged by Tn5 to a known genetic region in E. coli K-12, the major class of avirulent mutants defective in the core structure of lipopolysaccharide (LPS) was examined for the sites of Tn5 insertions. The two Notl segments created by the Tn5 insertion in the Notl fragment were analysed by Southern blotting with two DNA probes for the 5' and 3' flanking regions of the rfa region, and shown to hybridize separately with each of them, confirming the sites of Tn5 in the rfa locus. This approach will facilitate direct comparison genetically mapped Tn5 insertion mutations of S. flexneri with genes physically determined in E. coli K-12.
Mol Microbiol 1991 Sep
PMID:Construction of a physical map of the chromosome of Shigella flexneri 2a and the direct assignment of nine virulence-associated loci identified by Tn5 insertions. 166 62

Chemically induced hypothyroidism changes the functions of rat alveolar macrophages. Treatment of female rats with an anti-thyroid drug, methimazole (1% aqueous solution in drinking water for 6 weeks) significantly (p less than 0.05) reduced the ability of alveolar macrophages (MAM) to phagocytose and kill the yeast, Saccharomyces cerevisiae. Undigested yeasts were observed in phagolysosomes within MAM using transmission electron microscopy. The activities of the lysosomal enzymes, acid phosphatase and beta-glucuronidase, and the Fc receptor binding ability for immunoglobulin G, were lowered in MAM when compared with control macrophages (CAM). MAM also produced less tumor necrosis factor under the stimulation of lipopolysaccharide.
Virchows Arch B Cell Pathol Incl Mol Pathol 1991
PMID:Effect of methimazole-induced hypothyroidism on alveolar macrophages. 167 73

Activated macrophages participate in inflammation by eliminating foreign cells, promoting wound healing, and modulating the immune response. A murine monoclonal antibody, designated anti-rat macrophage activator (RMA), was raised against alveolar macrophages (AM) activated with interferon-gamma (IFN-gamma) and phorbol myristate acetate (PMA). The RMA antigen is expressed by resident macrophages but not by other cells. Binding to AM by anti-RMA is not competitively inhibited by the murine monoclonal antibodies MRC OX-41, OX-42, and OX-43. Surface membrane expression of RMA antigens is upregulated by lipopolysaccharide, PMA, and tumor necrosis factor-alpha but not by IFN-gamma. Stimulation of AM with anti-RMA yields distinct ultrastructural alterations, as well as de novo protein and DNA synthesis. Immunoprecipitation of [35S]methionine metabolically labeled AM yields a 120 kD protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) that is not altered by chemical reduction. We conclude that the RMA antigen is macrophage specific and that binding of anti-RMA to AM promotes functional activities in a subset of these cells.
Am J Respir Cell Mol Biol 1990 Feb
PMID:Anti-RMA: a murine monoclonal antibody that activates rat macrophages. I. Distribution and characterization of the RMA antigen. 168 87

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.
Mol Cell Biol 1990 Apr
PMID:Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells. 169 Aug 49

Granulocyte colony-stimulating factor (G-CSF) plays an essential role in granulopoiesis during bacterial infection. Macrophages produce G-CSF in response to bacterial endotoxins such as lipopolysaccharide (LPS). To elucidate the mechanism of the induction of G-CSF gene in macrophages or macrophage-monocytes, we have examined regulatory cis elements in the promoter of mouse G-CSF gene. Analyses of linker-scanning and internal deletion mutants of the G-CSF promoter by the chloramphenicol acetyltransferase assay have indicated that at least three regulatory elements are indispensable for the LPS-induced expression of the G-CSF gene in macrophages. When one of the three elements was reiterated and placed upstream of the TATA box of the G-CSF promoter, it mediated inducibility as a tissue-specific and orientation-independent enhancer. Although this element contains a conserved NF-kappa B-like binding site, the gel retardation assay and DNA footprint analysis with nuclear extracts from macrophage cell lines demonstrated that nuclear proteins bind to the DNA sequence downstream of the NF-kappa B-like element, but not to the conserved element itself. The DNA sequence of the binding site was found to have some similarities to the LPS-responsive element which was recently identified in the promoter of the mouse class II major histocompatibility gene.
Mol Cell Biol 1990 May
PMID:Regulatory elements responsible for inducible expression of the granulocyte colony-stimulating factor gene in macrophages. 169 38

Mast cells and basophils have been known to play a central role in allergic inflammation through the release of chemical mediators by cross-linkage of IgE receptors. The IgE receptor triggering and calcium ionophore A23187 have also been shown to induce gene expression and production of tumor necrosis factor (TNF) by rat basophilic leukemia cells. In the present study, we examined whether IgE receptor triggering could induce gene expression and production of TNF in rat lung tissue. The lung tissue released not only histamine but also cytotoxic activity on L929 cells 2 and 4 h after incubation with dinitrophenyl conjugated to ovalbumin (DNP-OVA) following passive sensitization with anti-DNP monoclonal rat IgE antibody, whereas neither DNP-OVA nor anti-DNP IgE antibody could induce the cytotoxic activity when used solely. Calcium ionophore A23187 also could induce both histamine release and cytotoxic activity. These activities induced by IgE receptor triggering, A23187, and lipopolysaccharide were completely neutralized by preincubation with anti-mouse TNF-rabbit serum, but not with normal rabbit serum. Northern blot analysis using cDNA probe of mouse TNF demonstrated expression of TNF gene as early as 2 h after IgE receptor triggering. These data demonstrating that IgE receptor triggering induced gene expression and production of TNF in lung tissue suggest the participation of TNF in the pathogenesis of late asthmatic response through its biologic activities such as the attraction and activation of neutrophils and eosinophils.
Am J Respir Cell Mol Biol 1990 Oct
PMID:Production of tumor necrosis factor with IgE receptor triggering from sensitized lung tissue. 169 98

Artificial Salmonella serogroup B, D or Cl-specific glycolipids were prepared by covalently linking oligosaccharides corresponding to two O-antigen repeating units, obtained by phage enzyme hydrolysis of native O-antigenic polysaccharides, to octyl residues. Sheep erythrocytes coated with the artificial glycolipids were studied for their ability to consume C3, when incubated in C4- deficient guinea pig serum. Salmonella C1 (0-6,7) glycolipid-coated erythrocytes consumed C3 40% more efficiently than Salmonella D (0-9,12) glycolipid-coated erythrocytes, and 10-times more efficiently than Salmonella B (0-4,12) glycolipid-coated erythrocytes. These results resemble C3 consumption by Salmonella C1, D, and B cells and by sheep erythrocytes coated with purified lipopolysaccharides of these O-specificities. The results prove directly that in a particulate system C3 activation via the alternative pathway depends on the structural properties of the O-antigenic side chain. Structures as small as octasaccharides, or as two O-antigenic repeating units, are sufficient for triggering C3 activation, but the magnitude of activation depends on the nature of the monosaccharides. Apparently, neither the core oligosaccharide nor Lipid A of lipopolysaccharide are required for C3 activation via the alternative pathway.
Mol Immunol 1990 Sep
PMID:Salmonella O antigen-specific oligosaccharide-octyl conjugates activate complement via the alternative pathway at different rates depending on the structure of the O antigen. 169 20


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>