Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Three "P-box" amino acids within the DNA recognition alpha-helix of members of the steroid hormone and thyroid hormone families of nuclear receptors are known to determine the identity of two of the six base pairs within the half-sites of cognate DNA elements. We introduced P-box substitutions derived from different members of the thyroid hormone/estrogen receptor (T3R/ER) family into the beta-isoform of human thyroid hormone receptor (hT3R beta) and tested the DNA binding and transactivation activities of these mutants using thyroid hormone response elements (TREs) with half-sites composed of different sequences and arranged in different orientations. Different P-box sequences derived from the T3R/ER family resulted in distinct DNA binding specificities determined by the fourth base pair of the half-site. Thyroid hormone receptor mutants containing EGA, EAA, EGS substitutions for the wild type EGG P-box bound with wild type affinity to consensus AGGTCA half-sites, regardless of orientation. TREs composed of AGGACA half-sites bound hT3R beta s with an EGG or EAA P-box sequence, but not those with EGA or EGS P-box sequence. A reversal of this specificity was observed on a direct repeat TRE with AGGGCA half-sites. Additionally, an ESG P-box substitution in hT3R beta prevented the receptor from binding to a direct repeat as a homodimer, but this mutant could bind as a heterodimer with retinoid X receptor or to the everted repeat TRE from the chicken lysozyme promoter.
Mol Endocrinol 1994 Jul
PMID:The effects of P-box substitutions in thyroid hormone receptor on DNA binding specificity. 798 45

L-thyroxine activated the Ca2+ release channel (ryanodine receptor) of skeletal muscle. [3H]ryanodine binding was stimulated by L-thyroxine in a dose dependent manner producing a two-fold increase at 250 microM. The same concentration induced a release of approximately 40% of the 45Ca2+ passively loaded into sarcoplasmic reticulum in 100 msec. Ca2+ release channel activity monitored in planar bilayers increased in the presence of 250 microM L-thyroxine from a control open probability of 0.02 +/- 0.03 to 0.17 +/- 0.12. Thyroid hormones may directly open Ca2+ release channels of skeletal muscle, thus altering intracellular Ca2+ homeostasis.
Biochem Mol Biol Int 1994 Mar
PMID:L-thyroxine activates the intracellular Ca2+ release channel of skeletal muscle sarcoplasmic reticulum. 803 13

Thyroid hormone (TH) metabolism is altered in cases of unconjugated hyperbilirubinemia. These effects might involve inhibition of TH uptake by their target cells. Astrocytes, which are in close contact with the membranes of brain capillaries, might be the first brain cells to come into contact with bilirubin. Cultured rat brain astrocytes were used as a model to study the effects of bilirubin and bilirubin analogues on TH uptake. The initial uptake of [125I]T3 and [125I]T4 was inhibited by unconjugated bilirubin, biliverdin, ditaurobilirubin and bilirubin glucuronides. The inhibition of T3 uptake by the bilirubin analogues was competitive. The Ki values were: unconjugated bilirubin (31 microM), biliverdin (48 microM), ditaurobilirubin (2.5 microM) and bilirubin glucuronides (1.2 microM). This last value is similar to the Km of T3 transport (0.4 microM), indicating that bilirubin glucuronides have a high affinity for the TH transport system. By contrast, the uptakes of [3H]tryptophan and ]3H]glutamine were not inhibited. These results suggest that the astrocyte plasma membrane bears specific bilirubin-interaction sites that are closely related to the TH transport system. However, uptake of [14C]bilirubin by cultured astrocytes was a non-saturable process. Binding of bilirubin to the astrocyte plasma membrane may inhibit the TH uptake and impair their metabolism and their action on the intracellular targets.
Mol Cell Endocrinol 1993 Nov
PMID:Competitive inhibition of thyroid hormone uptake into cultured rat brain astrocytes by bilirubin and bilirubin conjugates. 814 97

Thyroid hormone receptors (TRs) form heterodimers with retinoid X receptors (RXRs). Heterodimerization is required for efficient TR DNA binding to most response elements and transcriptional activation by thyroid hormone. RXRs also function as auxiliary proteins for several other receptors. In addition, RXR alpha can be induced by specific ligands to form homodimers. Here we report that RXR-specific retinoids that induce RXR homodimers are effective repressors of the T3 response. We provide evidence that this repression by RXR-specific ligands occurs by sequestering of RXR from TR-RXR heterodimers into RXR homodimers. This ligand-induced squelching may represent an important mechanism by which RXR-specific retinoids and 9-cis retinoic acid mediate hormonal cross talk among a subfamily of nuclear receptors activated by structurally unrelated ligands.
Mol Cell Biol 1993 Dec
PMID:Formation of retinoid X receptor homodimers leads to repression of T3 response: hormonal cross talk by ligand-induced squelching. 824 86

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)
 ...
PMID:Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site. 829 96

Thyroid hormones are essential for the normal growth and development of many tissues. In the rat, hypothyroidism is associated with growth impairment, and hyperthyroidism with the development of a hypercatabolic state and skeletal muscle wasting but, paradoxically, cardiac hypertrophy. The mechanism by which thyroid hormone produces cardiac hypertrophy and myosin isoenzyme changes remains unclear. The role of IGF-I, an anabolic hormone with both paracrine and endocrine actions, in producing cardiac hypertrophy was investigated during this study in hyperthyroid, hypothyroid and control rats. A treated hypothyroid group was also included in order to assess the effect of acute normalization of thyroid function. Body weight was significantly lower in the hyperthyroid (mean +/- S.E.M.; 535.5 +/- 24.9 g, P < 0.05), hypothyroid (245.3 +/- 9.8 g, P < 0.001) and treated hypothyroid (265.3 +/- 9.8 g, P < 0.001) animals when compared with controls (618.5 +/- 28.6 g). Heart weight/body weight ratios were, however, significantly increased in the hyperthyroid (2.74 +/- 0.11 x 10(-3), P < 0.01) and treated hypothyroid (2.87 +/- 0.07 x 10(-3), P < 0.001) animals when compared with controls (2.26 +/- 0.03 x 10(-3). Serum IGF-I concentrations were similar in the control and hyperthyroid rats (0.91 +/- 0.07 vs 0.78 +/- 0.04 U/ml, P = 0.26), but bioactivity was reduced by 70% in hyperthyroid serum, suggesting a circulating inhibitor of IGF. Serum IGF-I levels (0.12 +/- 0.03 U/ml, P < 0.001) and bioactivity (0.12 +/- 0.04 U/ml, P < 0.001) were significantly lower in the hypothyroid group. Liver IGF-I mRNA levels were not statistically different in the control and hyperthyroid animals, but were significantly reduced in the hypothyroid animals (P < 0.05 vs control). Heart IGF-I mRNA levels were similar in the control and hypothyroid rats, but were significantly increased in the hyperthyroid and treated hypothyroid animals (increased by 32% in hyperthyroidism, P < 0.05; increased by 57% in treated hypothyroidism, P < 0.01). Cardiac IGF-I was significantly elevated in hyperthyroidism (0.16 +/- 0.01 U/mg heart tissue, P < 0.01), was low in hypothyroidism (0.08 +/- 0.01 U/mg, P < 0.01) and was normalized in the treated hypothyroid group (0.11 +/- 0.01 U/mg vs control, 0.13 +/- 0.01 U/mg). Low body mass during both hypothyroidism and hyperthyroidism is therefore associated with reduced systemic IGF bioactivity. In hypothyroidism there is a primary defect in the endocrine function of IGF-I, while in hyperthyroidism serum IGF bioactivity is reduced in the presence of normal endocrine production of this anabolic hormone.(ABSTRACT TRUNCATED AT 400 WORDS)
J Mol Endocrinol 1993 Jun
PMID:Endocrine and cardiac paracrine actions of insulin-like growth factor-I (IGF-I) during thyroid dysfunction in the rat: is IGF-I implicated in the mechanism of heart weight/body weight change during abnormal thyroid function? 837 15

Thyroid hormone (T3) receptors (T3Rs) regulate transcription by binding to T3 response elements (TREs) located within promoter regions of T3-regulated genes. In rat pituitary GH4C1 cells, expression of a reporter containing herpes simplex virus thymidine kinase (TK) gene sequences (-105/+51) linked to the chloramphenicol acetyltransferase gene was stimulated 4- to 5-fold by T3. Linker scanning mutants of the TK promoter revealed that regions around -80 containing a CTF/NF-1 recognition sequence and around -10 are both required for regulation by T3. Endogenous T3Rs from GH4C1 cells labeled with [125I]T3 bound only to TK promoter DNA fragments containing the -10 region. The -22/-2 sequence (TK-TRE) contains half-sites oriented as an inverted repeat separated by 6 basepairs that are identical to and similar to an optimized TRE half-site. Purified chicken T3R alpha 1 forms apparent monomeric and dimeric complexes on the 32P-labeled TK-TRE, as found previously with an inverted repeat of the optimized TRE (TREp) with no basepair gap. T3 enhances the formation and alters the mobility of these complexes on both elements. When positioned up-stream of a heterologous promoter-chloramphenicol acetyltransferase reporter, the TK-TRE conferred T3 regulation by endogenous T3R in GH4C1 cells and by cotransfected chicken T3R alpha 1 in HeLa cells. The TK-TRE does not bind and is not activated by retinoic acid receptor. T3Rs and nuclear proteins from GH4C1, HeLa, and COS1 cells form heterodimers on the TK-TRE which differ in abundance and mobility from heterodimers formed on the TREp. The identification of a TRE in the TK promoter raises the possibility that T3R or related proteins may play important roles in regulating the life cycle of herpes simplex virus.
Mol Endocrinol 1993 Mar
PMID:The herpes simplex virus thymidine kinase gene promoter contains a novel thyroid hormone response element. 838 56

The expression of the rat growth hormone (rGH) gene in the anterior pituitary gland is modulated by Pit-1/GHF-1, a pituitary-specific transcription factor, and by other more widely distributed factors, such as the thyroid hormone receptors (TRs), Sp1, and the glucocorticoid receptor. Thyroid hormone (T3)-mediated transcriptional stimulation of rGH gene expression has been extensively studied in vivo and in vitro including the measurements of (i) rGH mRNA by blot hybridization, (ii) transcriptional rate of rGH gene by nuclear run-on, and (iii) reporter gene expression in which a chimeric plasmid containing 5'-flanking sequences of the rGH gene linked to a reporter gene has been transfected either stably or transiently into pituitary and/or nonpituitary cells. From these studies, it has been suggested that the Pit-1/GHF-1 binding site is necessary for full T3 action. We developed a cell-free in vitro transcription system to examine further the roles of the TRs and Pit-1/GHF-1 in rGH gene activation. Using GH3 nuclear extract as a source of TRs and Pit-1/GHF-1, this in vitro transcription assay showed that T3 stimulation of rGH promoter activity is dependent on the addition of T3 to the GH3 nuclear extract. This transcriptional stimulation was augmented with increasing concentrations of ligand and was T3, but not T4 or reverse T3, specific. T3-mediated stimulation of rGH promoter activity was completely abolished by preincubation of the nuclear extract with rGH-thyroid hormone response element (-200 to -160) but not with Pit-1/GHF-1 (-137 to -65) oligonucleotides. Further, neither deletion of both Pit-1/GHF-1 binding sites nor mutation of the proximal Pit-1/GHF-1 binding site from the rGH promoter abrogated the T3 effect. These results provide evidence that T3-stimulated rGH promoter activity is independent of Pit-1/GHF-1 and raise the possibility that the stimulation of rGH gene expression by T3 might involve direct interaction of TRs with the general transcriptional apparatus.
Mol Cell Biol 1993 Mar
PMID:Ligand-dependent, Pit-1/growth hormone factor-1 (GHF-1)-independent transcriptional stimulation of rat growth hormone gene expression by thyroid hormone receptors in vitro. 844 8

We have characterized the putative AP1 site in the backbone of pUC plasmids and found unique regulatory effects. The site, which mapped to a 19-bp region around nucleotide 37, conferred transcriptional activation by Jun or Jun/Fos that was boosted up to fivefold by unliganded thyroid hormone receptor (TR). Thyroid hormone changed potentiation of the Jun response by TR into repression. Although the plasmid sequence is a near-perfect consensus AP1 site, the perfect consensus AP1 site from the human collagenase promoter did not show the same effects. Deletion of the ligand binding domain of the TR eliminated the ability of the receptor to boost Jun activity, and deletion, mutation, or changes in specificity of the DNA binding domain eliminated both its ability to potentiate Jun activity and repress with hormone. In vitro Jun/Fos complexes bound the operative plasmid fragment, and the presence of TR interfered very little with Jun/Fos binding activity. Protein interaction studies in the absence of DNA showed that TR bound Jun protein in solution either in the presence or in the absence of hormone. These observations suggest a mechanism for synergy and repression by TR through modulation of Jun activity: positive when TR is unliganded, and negative when hormone is bound. They also suggest that the presence of the plasmid element can confound studies of the regulation of linked promoters.
Mol Cell Biol 1993 May
PMID:Positive and negative modulation of Jun action by thyroid hormone receptor at a unique AP1 site. 847 60

Ornithine-delta-aminotransferase (OAT) catalyzes the reversible transamination of ornithine to glutamate semialdehyde. OAT is abundant in liver, kidney and retina; hereditary deficiency of the enzyme leads to chorioretinal degeneration. Studies of OAT regulation in retinoblastomas have revealed an alternatively spliced OAT mRNA, which contains an additional exon (exon 2) in the 5' untranslated region. Estrogen and thyroid hormone were previously shown to increase OAT mRNA levels approximately 3-fold and 5-fold, respectively, in these cells. To determine the mechanism of hormonal action in retinoblastomas, we performed nuclear transcription assays and analyzed the distribution of OAT mRNAs in individual fractions of a polysome gradient. Thyroid hormone increased the rate of transcription of the OAT mRNA in these cells. Estrogen did not stimulate transcription; it was associated with increased translation, since it resulted in a shift of the major (spliced) OAT mRNA species into denser fractions of the polysome gradient. Cycloheximide treatment suggested that the latter effect was due to increased initiation of translation. The unspliced OAT mRNA, which is inefficiently compared to the spliced mRNA, was insensitive to estrogen in these experiments.
Mol Cell Endocrinol 1993 Jan
PMID:Translational control of ornithine-delta-aminotransferase (OAT) by estrogen. 849 98


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>