Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have used in vivo genomic footprinting to investigate the protein-DNA interactions within the conserved DNA elements (CDEI, CDEII, and CDEIII) in the centromere from chromosome III of the yeast Saccharomyces cerevisiae. The in vivo footprint pattern obtained from wild-type cells shows that some guanines within the centromere DNA are protected from methylation by dimethyl sulfate. These results are consistent with studies demonstrating that yeast cells contain sequence-specific centromere DNA-binding proteins. Our in vivo experiments on chromosomes with mutant centromeres show that some mutations which affect chromosome segregation also alter the footprint pattern caused by proteins bound to the centromere DNA. The results of this study provide the first fine-structure map of proteins bound to centromere DNA in living yeast cells and suggest a direct correlation between these protein-DNA interactions and centromere function.
Mol Cell Biol 1991 Jan
PMID:In vivo genomic footprint of a yeast centromere. 198 17

The ubiquitously expressed mouse Surf-1 and Surf-2 genes are divergently transcribed, and their heterogeneous start sites are separated by up to a maximum of only 73 bp. By using in vitro DNase I, dimethyl sulfate methylation, and gel retardation assays, we have identified five putative promoter control elements between and around the Surf-1 and Surf-2 start sites. The effects of each site on the regulation of Surf-1 and Surf-2 transcription have been studied in vivo, and four sites were found to be functional promoter elements. A novel binding site is required for efficient use of the intermediate but not the major start site of Surf-1. Three elements function in a bidirectional manner and are shared for efficient and accurate expression of both Surf-1 and Surf-2. One is an UEF (USF, MLTF) binding site which had a small effect on the use of the intermediate start sites of Surf-1 and also affected the major start sites of Surf-2. Another has sequence homology to the RPG alpha binding site associated with some ribosomal protein gene promoters and is required for efficient expression of the major but not intermediate start sites of Surf-1 and all start sites of Surf-2. The third, an RPG alpha-like site, is used for all start sites of both Surf-1 and Surf-2. Dissection of this cellular promoter region showed that different binding sites affect the use of different start sites and revealed a complex interaction between multiple elements that constitute a bona fide bidirectional promoter.
Mol Cell Biol 1991 Mar
PMID:The bidirectional promoter of the divergently transcribed mouse Surf-1 and Surf-2 genes. 199 91

ADR1 is a transcription factor from Saccharomyces cerevisiae that regulates ADH2 expression through a 22-bp palindromic sequence (UAS1). Size fractionation studies revealed that full-length ADR1 and a truncated ADR1 protein containing the first 229 amino acids, which has the complete DNA-binding domain, ADR1:17-229, exist as monomers in solution. However, two complexes were formed with target DNA-binding sites. UV-cross-linking studies suggested that these two complexes represent one and two molecules of ADR1 bound to DNA. Studies of ADR1 complexes formed with wild-type UAS1, asymmetrically altered UAS1, and one half of UAS1 showed that ADR1 can bind to one half of UAS1 and gives rise to a complex containing one molecule of ADR1. Dimethyl sulfate interference studies were consistent with this interpretation and in addition indicated that purine contact sites in each half of UAS1 were identical. Increasing the distance between the two halves of UAS1 had at most a minor effect of the thermodynamics of formation of the two complexes. These data are more consistent with ADR1 binding as two independent monomers, one to each half of UAS1. However, binding of two ADR1 monomers at UAS1 is apparently essential for transactivation in vivo. Further, we have identified a stretch of 18 amino acid residues amino terminal to the zinc two-finger domains of ADR1 which is essential for DNA-binding activity. Single amino acid substitutions of residues in this region resulted in severely reduced DNA-binding activity.
Mol Cell Biol 1991 Mar
PMID:Two monomers of yeast transcription factor ADR1 bind a palindromic sequence symmetrically to activate ADH2 expression. 199 9

We describe here for the first time successful application of the hydroxyl radical technique for genomic footprinting. In combination with two complementary techniques, DNase I footprinting and dimethyl sulfate methylation protection, we have obtained a high-resolution map of the promoter region of the yeast HSP82 heat shock gene, which resides within a constitutive nuclease hypersensitive site. We find that irrespective of transcriptional state, basal or induced, only one of three putative heat shock elements, HSE1, and the TATA box are tightly bound by proteins, presumably heat shock factor (HSF) and TFIID, respectively. Whereas the HSE1-associated factor binds tightly within the major groove of DNA, as discerned by protection of guanine residues from methylation by dimethyl sulfate in intact cells, the TATA factor appears to bind principally to the sugar-phosphate backbone, as revealed by strong protection from hydroxyl radical cleavage in whole-cell lysates. In addition, while HSE1 is strongly footprinted by DNase I in lysates, the TATA box is only weakly footprinted. Strikingly, both elements are associated with marked distortion of the DNA double helix in chromatin. Protein binding to HSE1 appears to cause a non-B-conformation, on the basis of a local 12 base-pair periodicity of hydroxyl radical protection and the presence of multiple DNase I hyperreactive cleavages flanking HSE1, whose pattern changes following heat shock. Similarly, helix distortion is evident in the vicinity of the TATA box, since hydroxyl radical detects a lower strand-specific hypersensitive site at the dyad center of an adjacent polypurine tract. Finally, the absence of discernable modulation in the DNase I cleavage pattern argues against the presence of a specifically positioned nucleosome within the IISP82 promoter region.
J Mol Biol 1990 Dec 05
PMID:Genomic footprinting of the yeast HSP82 promoter reveals marked distortion of the DNA helix and constitutive occupancy of heat shock and TATA elements. 217 61

The ilvGMEDA operon of Escherichia coli, which encodes four of the five enzyme activities required for the biosynthesis of isoleucine and valine, is preceded by tandem promoters ilvPG1 and ilvPG2 which are separated by 72 base pairs. While both of these promoters are transcriptionally active in vitro, only the operon proximal promoter, ilvPG2, is transcriptionally active in vivo, and upstream DNA sequences encoding the ilvPG1 promoter region enhance the in vivo transcriptional activity of the ilvPG2 promoter 60-fold. The binding of the integration host factor protein (IHF) to this upstream region (Tsui, P., and Freundlich, M. (1989) J. Mol. Biol. 203, 817-820) has been shown to repress transcription from the ilvPG1 promoter both in vivo and in vitro (Pereira, R. F., Ortuno, M. J., and Lawther, R. P. (1988) Nucleic Acids Res. 16, 5972-5989). Furthermore, E. coli strains deficient for IHF are compromised for isoleucine and valine biosynthesis (Friden, P., Voelkel, K., Sternglantz, R., and Freundlich, M. (1984) J. Mol. Biol. 172, 573-579). Therefore, in order to further understand this repressor/activator role of IHF, we have undertaken a detailed analysis of the interaction of IHF with the DNA sequences in the ilvPG1 promoter region. The results of hydroxyl radical footprinting, dimethyl sulfate protection, and ethylation interference experiments show that IHF binds to a target site that overlaps the ilvPG1 promoter region. The results of these experiments also demonstrate that IHF interacts primarily with the minor groove of the DNA helix and that the IHF target site in the ilvPG1 promoter region shares a high degree of DNA sequence identity with other high affinity IHF target sites involved in DNA replication and site-specific recombination.
 ...
PMID:Characterization of the integration host factor binding site in the ilvPG1 promoter region of the ilvGMEDA operon of Escherichia coli. 219 Sep 79

An overview of the chemical and photochemical probes which over the past ten years have been used in studies of DNA/ligand complexes and of non-B-form DNA conformations is presented with emphasis on the chemical reactions of the probes with DNA and on their present 'use-profile'. The chemical probes include: dimethyl sulfate, ethyl nitroso urea, diethyl pyrocarbonate, osmium tetroxide, permanganate, aldehydes, methidiumpropyl-EDTA-Fell (MPE), phenanthroline metal complexes and EDTA/FeII. The photochemical probes that have been used include: psoralens, UVB, acridines and uranyl salts. The biological systems analysed by use of these probes are reviewed by tabulation.
J Mol Recognit 1990 Feb
PMID:Chemical and photochemical probing of DNA complexes. 219 98

The VirG protein is a positive regulator for the virulence genes of which expression is induced by a plant factor, and is essential for Agrobacterium pathogenicity on dicotyledonous plants. The VirG protein of the hairy-root-inducing plasmid A4 was overproduced in Escherichia coli cells, and purified to homogeneity. DNase I footprinting experiments revealed that the purified VirG protein was bound to the upstream region of virulence genes including the phased vir box sequences, which had been presumed to be the VirG recognition signal from the sequence analysis. In dimethyl sulfate footprinting, the VirG protein specifically protected the guanine residues within every vir box sequence. It was concluded that the VirG protein was bound to the phased vir box sequences from the major groove along one side of double-helical DNA.
J Mol Biol 1990 Oct 20
PMID:Binding of the regulatory protein VirG to the phased signal sequences upstream from virulence genes on the hairy-root-inducing plasmid. 223 18

Dimethyl sulfate (DMS) genomic footprinting revealed the presence of putative regulatory proteins attached to specific sequences of the promoter region of the interferon (IFN) alpha-1 gene in normal human tissue. The pattern of protein-DNA interactions observed for the human alpha-1 promoter in freshly isolated human spleen cells was identical to that seen in DNA from the B-cell line Namalwa. The protein interactions involving the human IFN alpha-1 promoter spanned a region from positions -38 to -174 relative to the cap site which encompasses that part of the IFN alpha-1 promoter previously shown by deletion analysis to confer virus inducibility on the IFN alpha-1 gene. DNase I footprinting performed on isolated nuclei revealed a pattern of protein-DNA interactions for the promoter region of the IFN alpha-1 gene similar to that obtained with DMS footprinting performed on whole cells, with the appearance or disappearance of only a few additional protected nucleotides outside the region identified by the use of DMS. These results provide the first direct evidence for the presence of proteins bound in vivo to those parts of the IFN alpha-1 promoter between positions -64 and -109 previously shown by deletion analysis to confer virus inducibility on the IFN alpha-1 gene. The pattern of protein-DNA interactions observed for the IFN alpha-1 promoter after virus induction was identical to that seen before induction, in keeping with the finding that many transcriptional activators are present in both induced and uninduced cells.
Mol Cell Biol 1990 Jun
PMID:Genomic footprinting: detection of putative regulatory proteins in the promoter region of the interferon alpha-1 gene in normal human tissues. 234 57

The nucleoprotein structure of telomeres from Euplotes crassus was studied by using nuclease and chemical footprinting. The macronuclear telomeres were found to exist as DNA-protein complexes that are resistant to micrococcal nuclease digestion. Each complex encompassed 85 to 130 base pairs of macronuclear DNA and appeared to consist of two structural domains that are characterized by dissimilar DNA-protein interactions. Dimethyl sulfate footprinting demonstrated that very sequence-specific and salt-stable interactions occur in the most terminal region of each complex. DNase I footprinting indicated that DNA in the region 30 to 120 base-pairs from the 5' end lies on a protein surface; the interactions in this region of the complex are unlikely to be sequence specific. A 50-kilodalton telomere-binding protein was isolated. Binding of this protein protected telomeric DNA from BAL 31 digestion and gave rise to many of the sequence-specific DNA-protein interactions that were observed in vivo. The telomeric complexes from E. crassus were very similar in overall structure to the complexes found at Oxytricha telomeres. However, telomeric complexes from the two ciliates showed significant differences in internal organization. The telomeric DNA, the telomere-binding proteins, and the resultant DNA-protein interactions were all somewhat different. The telomere-binding proteins from the two ciliates were found to be less closely conserved than might have been expected. It appears that the proteins are tailored to match their cognate telomeric DNA.
Mol Cell Biol 1990 Jul
PMID:Telomere structure in Euplotes crassus: characterization of DNA-protein interactions and isolation of a telomere-binding protein. 235 12

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.
Mol Cell Biol 1990 Oct
PMID:DNA-binding protein activated by gamma radiation in human cells. 239 92


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>