Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

To study regulation of the (Ds) transposition process in heterologous plant species, the transposase gene of Ac was fused to several promoters that are active late during plant development. These promoters are the flower-specific chalcone synthase A promoter (CHS A), the anther-specific chalcone isomerase B promoter CHI B and the pollen-specific chalcone isomerase A2 promoter CHI A2. The modified transposase genes were introduced into a tobacco tester plant. This plant contains Ds stably inserted within the leader sequence of the hygromycin resistance (HPT II) gene. As confirmed with positive control elements, excision of Ds leads to the restoration of a functional HPT II gene and to a hygromycin resistant phenotype. No hygromycin resistance was observed in negative control experiments with Ac derivatives lacking 5' regulatory sequences. Although transactivation of Ds was observed after the introduction of transposase gene fusions in calli, excision in regenerated plants was observed only for the CHS A- or CHI B-transposase gene fusions. With these modified transposase genes, somatic excision frequencies were increased (68%) and decreased (22%), respectively, compared to the situation with the Ac element itself (38%). The shifts in transactivation frequencies were not associated with significant differences in the frequencies of germinally transmitted excision events (approximately 5%). The relative somatic stability of Ds insertions bearing the CHI B-transposase gene fusion suggests the usefulness of this activator element for transposon tagging experiments.
Mol Gen Genet 1992 Feb
PMID:Transactivation of Ds by Ac-transposase gene fusions in tobacco. 131 5

Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.
Mol Biol (Mosk)
PMID:[Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction]. 133 58

Infective (nodulating) Rhizobium leguminosarum biovar viciae (R.l. viciae) bacteria release Nod factors which stimulate the release of nodulation gene-inducing flavanones and chalcones from roots of the host plant Vicia sativa subsp. nigra (K. Recourt et al., Plant Mol Biol 16: 841-852; H.P. Spaink et al., Nature 354: 125-130). The hypothesis that this release results from increased synthesis of flavonoids was tested by studying the effect of inoculation of V. sativa with infective and uninfective R.l. viciae bacteria on (i) activity of L-phenylalanine ammonia-lyase, (ii) level of chalcone synthase mRNA, and (iii) activity of (eriodictyol) methyltransferase in roots. Consistent with the hypothesis, each of these parameters was found to increase 1.5 to 2-fold upon inoculation with infective R.l. viciae bacteria relative to the situation for uninoculated roots and for roots inoculated with uninfective rhizobia.
Plant Mol Biol 1992 Jun
PMID:Activation of flavonoid biosynthesis in roots of Vicia sativa subsp. nigra plants by inoculation with Rhizobium leguminosarum biovar viciae. 137 64

A cDNA library of Brassica napus (cv. Westar) was constructed using poly(A)+ RNA isolated from developing anthers of flower buds 2-3 mm in length. Differential hybridization, using cDNA probes complementary to poly(A)+ RNA from developing anthers or seedlings, was used for initial screening. In addition to Southern and Northern blot analyses of selected clones, RNA-PCR assays and in situ hybridization were used to study the temporal and spatial gene regulation in anthers at the transcriptional level. Five independent cDNA clones, showing no cross-hybridization to one another, were characterized, and their expression patterns could be grouped into three distinct categories. Two cDNA clones, BA112 and BA158, are tapetum-specific: the corresponding mRNAs accumulate in young anthers and decline as the tapetum cells degenerate later in anther development. The transcripts represented by BA54 and BA73 accumulate late in anther development and reach a maximum level in mature anthers prior to anthesis; BA54 has been confirmed to be pollen-specific. The third category, represented by BA42, is found to encode a protein sharing 64-67% amino acid similarity with chalcone synthase (CHS) from various plant species; the transcript is localized in the peripheral cells of the vascular bundle, tapetum, and developing microspores.
Mol Gen Genet 1992 Sep
PMID:Brassica anther-specific genes: characterization and in situ localization of expression. 140 84

A chimeric gene consisting of a bean (Phaseolus vulgaris L.) chalcone synthase (CHS) promoter fused to a bacterial chloramphenicol acetyltransferase (CAT) reporter gene was strongly expressed, and further induced by fungal elicitor, when electroporated into alfalfa (Medicago sativa L.) suspension cell protoplasts. Functional analysis of 5' deletions of the CHS promoter-CAT construct in these protoplasts indicated that the region between -326 and -130 contained both activator and silencer elements. Co-electroporation experiments confirmed that these cis-acting elements were binding sites for functionally active trans factors. In vitro DNase I footprinting revealed four potential binding sites for alfalfa suspension cell nuclear proteins between positions -326 and -130 of the CHS promoter. These sites mapped to regions shown to contain functional cis-acting elements on the basis of the deletion analysis. Three of these sites mapped to previously identified binding sites for bean nuclear proteins. Competition gel retardation analysis using oligonucleotide probes containing binding site sequences revealed sequence-specific binding of alfalfa nuclear proteins to an AT-rich element and a putative GT-1 factor consensus binding sequence. Our results define cis elements and their cognate trans factors functionally active in determining the quantitative expression of a defense response gene in a heterologous transient expression system.
Plant Mol Biol 1991 May
PMID:Stress responses in alfalfa (Medicago sativa L.). 8. Cis-elements and trans-acting factors for the quantitative expression of a bean chalcone synthase gene promoter in electroporated alfalfa protoplasts. 185 70

Genomic DNA from mustard was cloned in EMBL4 and screened for chalcone synthase (CHS) genes using a heterologous cDNA probe from parsley. Two clones which hybridized with the parsley cDNA probe were isolated. They showed different restriction patterns. One clone was sequenced and identified as a CHS gene by sequence comparison with published CHS sequences. The sequence of the coding region is 1188 bp, and encodes a protein of 43 kDa. The start-point of transcription was determined by primer extension. The sequence of 0.9 kbp at the 5' end of the transcription start and part of the noncoding 3' of this gene were also determined. The coding sequence is interrupted by a single intron of 523 bp. The coding and the noncoding 5' sequence of this gene was compared with CHS genes from other species. A very high homology was found with the Arabidopsis CHS coding region. A sequence motif (CACGTGT) which is present in most rbcS and all CHS upstream regions, and which specifically binds a protein factor from plant nuclear extracts, is also present in the upstream region of the mustard CHS gene. Measurements of CHS transcript levels show that phytochrome controls expression of this gene in cotyledons of mustard seedlings; however, blue/UV-light photoreceptors control expression in later stages of development.
Plant Mol Biol 1991 Feb
PMID:Cloning and characterization of a chalcone synthase gene from mustard and its light-dependent expression. 189 96

Bean nuclear extracts were used in gel retardation assays and DNase I footprinting experiments to identify a protein factor, designated SBF-1, that specifically interacts with regulatory sequences in the promoter of the bean defense gene CHS15, which encodes the flavonoid biosynthetic enzyme chalcone synthase. SBF-1 binds to three short sequences designated boxes 1, 2 and 3 in the region -326 to - 173. This cis-element, which is involved in organ-specific expression in plant development, functions as a transcriptional silencer in electroporated protoplasts derived from undifferentiated suspension-cultured soybean cells. The silencer element activates in trans a co-electroporated CHS15-chloramphenicol acetyl-transferase gene fusion, indicating that the factor acts as a repressor in these cells. SBF-1 binding in vitro is rapid, reversible and sensitive to prior heat or protease treatment. Competitive binding assays show that boxes 1, 2 and 3 interact cooperatively, but that each box can bind the factor independently, with box 3 showing the strongest binding and box 2 the weakest binding. GGTTAA(A/T)(A/T)(A/T), which forms a consensus sequence common to all three boxes, resembles the binding site for the GT-1 factor in light-responsive elements of the pea rbcS-3A gene, which encodes the small subunit of ribulose bisphosphate carboxylase. Binding to the CHS15 -326 to -173 element, and to boxes 1, 2 or 3 individually, is competed by the GT-1 binding sequence of rbcS-3A, but not by a functionally inactive form, and likewise the CHS sequences can compete with authentic GT-1 sites from the rbcS-3A promoter for binding.(ABSTRACT TRUNCATED AT 250 WORDS)
Plant Mol Biol 1991 Feb
PMID:Silencer region of a chalcone synthase promoter contains multiple binding sites for a factor, SBF-1, closely related to GT-1. 189 99

Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.
Plant Mol Biol 1991 Oct
PMID:Water deficit modulates gene expression in growing zones of soybean seedlings. Analysis of differentially expressed cDNAs, a new beta-tubulin gene, and expression of genes encoding cell wall proteins. 191 87

Twelve loci have previously been identified in tomato (Lycopersicon esculentum) that control the intensity and distribution of anthocyanin pigmentation; these are useful genetic markers because they encode phenotypes that are readily visualized in the hypocotyls of emerging seedlings. In order to obtain molecular probes for tomato anthocyanin biosynthesis genes, we isolated two cDNAs which encode chalcone synthase (CHS), one of the key enzymes in anthocyanin biosynthesis, from a tomato hypocotyl cDNA library. By comparing their nucleic acid sequences, we determined that the two CHS cDNAs have an overall similarity of 76% at the nucleotide level and 88% at the amino acid level. We identified hybridization conditions that would distinguish the two clones and by Northern analysis showed that 1.5 kb mRNA species corresponding to each cDNA were expressed in cotyledons, hypocotyls and leaves of wild-type seedlings. Hybridization of the cDNAs at low stringency to genomic blots indicated that in tomato, CHS genes comprise a family of at least three individual members. The two genes that encode the CHS cDNAs were then placed onto the tomato genetic map at unique loci by restriction fragment length polymorphism mapping. We also assayed the activity of CHS and another enzyme in the anthocyanin pathway, flavone 3-hydroxylase, in hypocotyl extracts of wild-type tomato and a number of anthocyanin-deficient mutants. Five mutants had reduced CHS activity when compared to the wild-type controls. Of these, three were also reduce in flavone 3-hydroxylase activity, suggesting a regulatory role for these loci. The other two mutants were preferentially reduced in CHS activity, suggesting a more specific role for these loci in CHS expression.
Mol Gen Genet 1990 Nov
PMID:Molecular genetic analysis of chalcone synthase in Lycopersicon esculentum and an anthocyanin-deficient mutant. 198 May 24

To establish a genetic system for dissection of light-mediated signal transduction in plants, we analyzed the light wavelengths and promoter sequences responsible for the light-induced expression of the Arabidopsis thaliana chalcone synthase (CHS) promoter fused to the beta-glucuronidase (GUS) marker gene. Transgenic A. thaliana lines carrying 1975, 523, 186, and 17 bp of the CHS promoter fused to the GUS gene were generated, and the expression of these chimeric genes was monitored in response to high intensity light in mature plants and to different wavelengths of light in seedlings. Fusion constructs containing 1975 and 523 bp of CHS promoter sequence behaved identically to the endogenous CHS gene under all conditions. Expression of these constructs was induced specifically in response to high intensity white light and blue light. The response to blue light was seen in the presence of the Pfr form of phytochrome. Fusion constructs containing 186 bp of promoter sequence showed reduced basal levels of expression and only weak stimulation by blue light but were induced significantly by high intensity white light. These analyses showed that the expression of the A. thaliana CHS gene is responsive to a specific blue light receptor and that sequences between -523 and -186 bp are required for optimal basal and blue light-induced expression of this gene. The experiments lay the foundation for a simple genetic screen for light response mutants.
Mol Gen Genet 1991 May
PMID:High intensity and blue light regulated expression of chimeric chalcone synthase genes in transgenic Arabidopsis thaliana plants. 203 7


1 2 3 4 5 6 7 8 9 10 Next >>