Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Numerous genes contain TATAA-less promoters, and the control of transcriptional initiation in this important promoter class is not understood. We have determined that protein-DNA interactions at three of the four proximal GC box sequence elements in one such promoter, that of the hamster
dihydrofolate reductase
gene, control initiation and relative use of the major and minor start sites. Our results indicate that although the GC boxes are apparently equivalent with respect to factor binding, they are not equivalent with respect to function. At least two properly positioned GC boxes were required for initiation of transcription. Abolishment of DNA-protein interaction by site-specific mutation of the most proximal GC box (box I) resulted in a fivefold decrease in transcription from the major initiation site and a threefold increase in heterogeneous transcripts initiating from the vicinity of the minor start site in vitro and in vivo. Mutations that separately abolished interactions at GC boxes II and III while leaving GC box I intact affected the relative utilization of both the major and minor initiation sites as well as transcriptional efficiency of the promoter template in in vitro transcription and transient expression assays. Interaction at GC box IV when the three proximal boxes were in a wild-type configuration had no effect on transcription of the
dihydrofolate reductase
gene promoter. Thus, GC box interactions not only are required for efficient transcription but also regulate start site utilization in this TATAA-less promoter.
Mol
Cell Biol 1990 Dec
PMID:Transcriptional initiation is controlled by upstream GC-box interactions in a TATAA-less promoter. 224 77
The pattern of mutations produced by a mutator gene (obtained during serial selection for amplification of the
dihydrofolate reductase
[dhfr] locus) shows a pronounced shift from that found in wild-type cells. The rate of certain types of base substitutions (particularly transitions) is dramatically increased, while gene rearrangements constitute a lower proportion of mutations. These data suggest a lower fidelity of the replication process in the mutator strain.
Mol
Cell Biol 1990 Dec
PMID:Increased rate of base substitution in a hamster mutator strain obtained during serial selection for gene amplification. 224 84
The earliest replicating portion of the Chinese hamster
dihydrofolate reductase
domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J.
Mol
. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the
DHFR
replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.
...
PMID:Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures. 225 31
This paper considers some of the landscape problems encountered in matching molecules by simulated annealing. Although the method is in theory ergodic, the global minimum in the objective function is not always encountered. Factors inherent in the molecular data that lead the trajectory of the minimization away from its optimal route are analysed. Segments comprised of the C alpha atoms of
dihydrofolate reductase
are used as test data. The evolution of a reverse ordering landscape problem is examined in detail. Where such patterns in the data could lead to incorrect matches, the problem can in part be circumvented by assigning an initial random ordering to the molecules.
J Comput Aided
Mol
Des 1990 Sep
PMID:Molecular structure matching by simulated annealing. II. An exploration of the evolution of configuration landscape problems. 228 Feb 67
The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified
dihydrofolate reductase
domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
J
Mol
Biol 1990 Jan 05
PMID:Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. 229 70
We have identified a sequence element that specifies the position of transcription initiation for the
dihydrofolate reductase
gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the
dihydrofolate reductase
promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the
dihydrofolate reductase
initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the
dihydrofolate reductase
initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the
dihydrofolate reductase
initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Mol
Cell Biol 1990 Feb
PMID:Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site. 230 58
To delineate segments of the genome of the human protozoan parasite Leishmania major necessary for replication and expression, we developed a vector (pR-NEO) which can be reproducibly introduced into L. major. This DNA was derived from a 30-kilobase extrachromosomal amplified DNA bearing the
dihydrofolate reductase
-thymidylate synthase gene, with the coding region for neomycin phosphotransferase substituted for that of
dihydrofolate reductase
-thymidylate synthase and a bacterial origin of replication and selectable marker added. G418-resistant lines were obtained at high efficiency by electroporation of pR-NEO (approaching 10(-4) per cell), while constructs bearing an inverted neo gene or lacking Leishmania sequences did not confer resistance. pR-NEO replicated in L. major and gave rise to correctly processed transcripts bearing the trans-spliced miniexon. Molecular karyotype analysis showed that in some lines pR-NEO DNA exists exclusively as an extrachromosomal circle, a finding supported by the rescue of intact pR-NEO after transformation of Escherichia coli. These data genetically localize all elements required in cis for DNA replication, transcription, and trans splicing to the Leishmania DNA contained within pR-NEO DNA and signal the advent of stable transfection methodology for addressing molecular phenomena in trypanosomatid parasites.
Mol
Cell Biol 1990 Mar
PMID:Stable transfection of the human parasite Leishmania major delineates a 30-kilobase region sufficient for extrachromosomal replication and expression. 230 58
We recently showed that replication initiates in the early S period at two closely spaced zones in the 240-kilobase (kb)
dihydrofolate reductase
(
DHFR
) amplicon of the methotrexate-resistant Chinese hamster ovary cell line CHOC 400. Both of these initiation loci (ori-beta and ori-gamma) have previously been cloned in a recombinant cosmid. In this study, we identified a third early-firing initiation locus (ori-alpha) in the much larger
DHFR
amplicon of the independently isolated methotrexate-resistant Chinese hamster cell line DC3F-A3/4K (A3/4K). We describe the molecular cloning of this newly identified locus and demonstrate by chromosomal walking that ori-alpha lies approximately 240 kb upstream from ori-beta. Using overlapping cosmid clones for more than 450 kb of DNA sequence from this region of the
DHFR
domain, we have monitored the replication pattern of the amplicons in synchronized A3/4K cells. These studies suggest that ori-alpha, ori-beta, and ori-gamma are the only early-firing initiation sites in this 450-kb sequence. In addition, we have been able to roughly localize the termini between ori-alpha and ori-beta and between ori-alpha and the next origin in the 5' direction. Thus, we have now isolated the equivalent of three early-firing replicons (including their origins) from a well-characterized chromosomal domain. With these tools, it should be possible to determine those properties that are shared by the origins and termini of different replicons and which are therefore likely to be functionally significant.
Mol
Cell Biol 1990 Apr
PMID:Multiple origins of replication in the dihydrofolate reductase amplicons of a methotrexate-resistant chinese hamster cell line. 232 1
The murine
dihydrofolate reductase
gene is regulated by a bidirectional promoter that lacks a TATA box. To identify the DNA sequences required for
dihydrofolate reductase
transcription, the activities of various templates were determined by in vitro transcription analysis. Our data indicate that sequences both upstream and downstream of the transcription initiation site modulate the activity of the
dihydrofolate reductase
promoter. We have focused on two regions downstream of the transcription initiation site that are important in determining the overall efficiency of the promoter. Region 1, which included exon 1 and part of intron 1, could stimulate transcription when placed in either orientation in the normal downstream position and when inserted upstream of the transcription start site. This region could also stimulate transcription in trans when the enhancer was physically separate from the promoter. Deletion of region 2, spanning 46 nucleotides of the 5' untranslated region, reduced transcriptional activity by fivefold. DNase I footprinting reactions identified protein-binding sites in both downstream stimulatory regions. Protein bound to two sites in region 1, both of which contain an inverted CCAAT box. The protein-binding site in the 5' untranslated region has extensive homology to binding sites in promoters that both lack (simian virus 40 late) and contain (adenovirus type 2 major late promoter and c-myc) TATA boxes.
Mol
Cell Biol 1990 Apr
PMID:Sequences downstream of the transcription initiation site modulate the activity of the murine dihydrofolate reductase promoter. 232 3
A general method for determining the physical location of an origin of bidirectional DNA replication has been developed recently and shown to be capable of correctly identifying the simian virus 40 origin of replication (L. Vassilev and E. M. Johnson, Nucleic Acids Res. 17:7693-7705, 1989). The advantage of this method over others previously reported is that it avoids the use of metabolic inhibitors, the requirement for cell synchronization, and the need for multiple copies of the origin sequence. Application of this method to exponentially growing Chinese hamster ovary cells containing the nonamplified, single-copy
dihydrofolate reductase
gene locus revealed that DNA replication begins bidirectionally in an initiation zone approximately 2.5 kilobases long centered about 17 kilobases downstream of the
DHFR
gene, coinciding with previously described early replicating sequences. These results demonstrate the utility of this mapping protocol for identifying cellular origins of replication and suggest that the same cellular origin is used in both the normal and the amplified
DHFR
locus.
Mol
Cell Biol 1990 Sep
PMID:Mapping an origin of DNA replication at a single-copy locus in exponentially proliferating mammalian cells. 238 21
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>