Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Rats of the Wistar/Af/Han/Mol/(Han 67) strain have previously been shown to respond in a variable way to phenobarbital treatment, as far as the induction of aldehyde dehydrogenase activity is concerned (Marselos 1976). This biochemical property is genetically determined and concerns the high-Km aldehyde dehydrogenase of the hepatic cytosol. In this study, administration of phenobarbital (1 mg/mo of drinking water, for 1 week) produces a uniform induction of aldehyde dehydrogenase in all rats, when measured with micromolar substrate concentration. The inducible low-Km enzyme of the cytosol is not genetically determined like the high-Km enzyme, and shows a wide specificity for aliphatic as well as for aromatic aldehydes. Despite the inducibility of the cytosolic enzymes, no alterations are found in the mitochondrial aldehyde dehydrogenase activities after phenobarbital treatment. The oxidation of D-glucuronolactone takes place only in the cytosol, and seems to be dependent on the low-Km aldehyde dehydrogenase. This is consistent with NMR studies, which showed that a very minimal amount of D-glucuronolactone is in aldehyde form under the measurement conditions usually applied. Further, the oxidation of D-glucuronolactone is also enhanced by phenobarbital in all rats without a genetic predisposition, and its dose-response curve is very similar to that of the low-Km aldehyde dehydrogenase.
...
PMID:Inducible aldehyde dehydrogenases in the hepatic cytosol of the rat. 57 55

Many of the structural proteins of ocular lenses, commonly referred to as crystallins, are identical to specific enzymes or the result of a recent gene duplication (Piatigorsky, J., and Wistow, G. (1991) Science 252, 1078-1079). One such enzyme, aldehyde dehydrogenase (ALDH), has been recruited as a lens crystallin in certain mammals (Wistow, G., and Kim, H. (1991) J. Mol. Evol. 32, 262-269) and cephalopods (Tomarev, S., Zinovieva, R., and Piatigorsky, J. (1991) J. Biol. Chem. 266, 24226-24231). We report here that a transparent tissue, derived from muscle but functioning as a lens in the light-emitting organ of a squid, Euprymna scolopes, shows striking biochemical convergence with the epidermally derived ocular lenses of some mammals and cephalopods. In the light organ lens of E. scolopes, an ALDH-like protein is the predominant molecular component. The typical muscle-specific proteins are replaced as the dominant species by a protein composed of 54-kDa subunits. This protein, which we designate as L-crystallin, constitutes approximately 70% of the total soluble protein of the light organ lens. The amino acid sequences of three peptides of L-crystallin (approximately 9% of the total protein) showed 54.5% sequence identity with human cytosolic ALDH. Using polyclonal antiserum made against L-crystallin, we found that it is present in low abundance in other tissues of the squid, including muscle and the ocular lens. This polyclonal antiserum also cross-reacted with the ALDH-like crystallins found in the ocular lenses of certain mammals and cephalopods. L-Crystallin showed no ALDH activity, which is similar to several other enzyme/crystallins, including ALDH/eta-crystallin (Wistow, G., and Kim, H. (1991) J. Mol. Evol. 32, 262-269). The characteristics of this muscle-derived lens are evidence that a common biochemical basis underlies transparency and that certain proteins may possess properties that promote their selection as lens structural proteins.
...
PMID:The muscle-derived lens of a squid bioluminescent organ is biochemically convergent with the ocular lens. Evidence for recruitment of aldehyde dehydrogenase as a predominant structural protein. 140 Apr 15

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.
Mol Cell Biol 1992 Sep
PMID:Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression. 150 12

Aldehydes are highly reactive molecules that may have a variety of effects on biological systems. They can be generated from a virtually limitless number of endogenous and exogenous sources. Although some aldehyde-mediated effects such as vision are beneficial, many effects are deleterious, including cytotoxicity, mutagenicity, and carcinogenicity. A variety of enzymes have evolved to metabolize aldehydes to less reactive forms. Among the most effective pathways for aldehyde metabolism is their oxidation to carboxylic acids by aldehyde dehydrogenases (ALDHs). ALDHs are a family of NADP-dependent enzymes with common structural and functional features that catalyze the oxidation of a broad spectrum of aliphatic and aromatic aldehydes. Based on primary sequence analysis, three major classes of mammalian ALDHs--1, 2, and 3--have been identified. Classes 1 and 3 contain both constitutively expressed and inducible cytosolic forms. Class 2 consists of constitutive mitochondrial enzymes. Each class appears to oxidize a variety of substrates that may be derived either from endogenous sources such as amino acid, biogenic amine, or lipid metabolism or from exogenous sources, including aldehydes derived from xenobiotic metabolism. Changes in ALDH activity have been observed during experimental liver and urinary bladder carcinogenesis and in a number of human tumors, including some liver, colon, and mammary cancers. Changes in ALDH define at least one population of preneoplastic cells having a high probability of progressing to overt neoplasms. The most common change is the appearance of class 3 ALDH dehydrogenase activity in tumors arising in tissues that normally do not express this form. The changes in enzyme activity occur early in tumorigenesis and are the result of permanent changes in ALDH gene expression. This review discusses several aspects of ALDH expression during carcinogenesis. A brief introduction examines the variety of sources of aldehydes. This is followed by a discussion of the mammalian ALDHs. Because the ALDHs are a relatively understudied family of enzymes, this section presents what is currently known about the general structural and functional properties of the enzymes and the interrelationships of the various forms. The remainder of the review discusses various aspects of the ALDHs in relation to tumorigenesis. The expression of ALDH during experimental carcinogenesis and what is known about the molecular mechanisms underlying those changes are discussed. This is followed by an extended discussion of the potential roles for ALDH in tumorigenesis. The role of ALDH in the metabolism of cyclophosphamidelike chemotherapeutic agents is described. This work suggests that modulation of ALDH activity may an important determinant of the effectiveness of certain chemotherapeutic agents.(ABSTRACT TRUNCATED AT 400 WORDS)
Crit Rev Biochem Mol Biol 1992
PMID:Aldehyde dehydrogenases and their role in carcinogenesis. 152 60

About 50% of Japanese have been estimated to possess at least one ALDH2*2 allele with a substitution of AAA for GAA at codon 487 of the aldehyde dehydrogenase gene. This mutation is tightly associated with the sensitivity of an individual to alcohol. We developed a method of identifying the ALDH2*2 allele by a non-radioactive technique. DNA from individuals was subjected to polymerase chain reaction in which part of the aldehyde dehydrogenase 2 gene was amplified. After dot-blotting onto nylon membranes, the DNA was hybridized with biotin-labelled allele-specific oligonucleotides. Determination of genotypes on 77 unrelated healthy Japanese individuals, using the conventional method and our new method with gradient hybridization temperature and competitive oligonucleotides, indicated that the latter was superior to the former.
Mol Cell Probes 1992 Aug
PMID:A non-radioactive method for the detection of a common mutant allele of aldehyde dehydrogenase 2. 152 4

The eye lens crystallins of the octopus Octopus dofleini were identified by sequencing abundant proteins and cDNAs. As in squid, the octopus crystallins have subunit molecular masses of 25-30 kDa, are related to mammalian glutathione S-transferases (GST), and are encoded in at least six genes. The coding regions and deduced amino acid sequences of four octopus lens cDNAs are 75-80% identical, while their non-coding regions are entirely different. Deduced amino acid sequences show 52-57% similarity with squid GST-like crystallins, but only 20-25% similarity with mammalian GST. These data suggest that the octopus and squid lens GST-like crystallin gene families expanded after divergence of these species. Northern blot hybridization indicated that the four octopus GST-like crystallin genes examined are lens-specific. Lens extracts showed about 40 times less GST activity using 1-chloro-2,4-dinitrobenzene as substrate than liver extracts of the octopus, indicating that the major GST-like crystallins are specialized for a lens structural role. A prominent 59-kDa crystallin polypeptide, previously observed in octopus but not squid and called omega-crystallin (Chiou, S.-H. (1988) FEBS Lett. 241, 261-264), has been identified as an aldehyde dehydrogenase. Since cytoplasmic aldehyde dehydrogenase is a major protein in elephant shrew lenses (eta-crystallin; Wistow, G., and Kim, H. (1991) J. Mol. Evol. 32, 262-269) the octopus aldehyde dehydrogenase crystallin provides the first example of a similar enzyme-crystallin in vertebrates and invertebrates. The use of detoxification stress proteins (GST and aldehyde dehydrogenase) as cephalopod crystallins indicates a common strategy for recruitment of enzyme-crystallins during the convergent evolution of vertebrate and invertebrate lenses. For historical reasons we propose that the octopus GST-like crystallins, like those of the squid, are called S-crystallins.
...
PMID:Crystallins of the octopus lens. Recruitment from detoxification enzymes. 172 Oct 68

The effect that variation in activities of the enzymes alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) has on the flux from 14C-ethanol to lipids was examined in third-instar larvae of Drosophila melanogaster and D. simulans. The activities of ADH and ALDH were also nutritionally manipulated by the inhibitor, cyanamide. Feeding larvae cyanamide before the flux test eliminated greater than 98% of the ALDH activity but only 40% of the ADH activity. The mean +/- SD flux control coefficient for ADH activity was 0.86 +/- 0.12, and that for ALDH activity was 0.02 +/- 0.07. This suggests that ADH is the major rate-limiting enzyme for the ethanol-to-lipid pathway in Drosophila larvae under the current experimental conditions.
Mol Biol Evol 1991 Sep
PMID:Metabolic control analysis and enzyme variation: nutritional manipulation of the flux from ethanol to lipids in Drosophila. 176 65

The meta operon of the Pseudomonas putida TOL plasmid (pWWO) encodes all enzymes of a meta-cleavage pathway for the metabolism of benzoic acids to Krebs-cycle intermediates. We have determined and analysed the nucleic acid sequence of a 3442 bp region of the meta operon containing the xyl-GFJ genes whose products are involved in the post meta-ring fission transformation of catechols. Homology analysis of the xylGFJ gene products revealed evidence of biochemical relatedness, suggested enzymatic mechanisms, and permitted us to propose evolutionary events which may have generated the current variety of aromatic degradative pathways. The xylG gene, which specifies 2-hydroxymuconic semialdehyde dehydrogenase (HMSD), was found to encode a protein of 51.7 kDa. The predicted protein sequence exhibits significant homology to eukaryotic aldehyde dehydrogenases (ADHs) and to the products of two other Pseudomonas catabolic genes, i.e. xylC and alkH. Expansion of the ADH superfamily to include these prokaryotic enzymes permitted a broader analysis of functionally critical ADH residues and phylogenetic relationships among superfamily members. The importance of three regions of these enzymes previously thought to be critical to ADH activity was reinforced by this analysis. However glutamine-487, also thought to be critical, is less well conserved. The revised ADH phylogeny proposed here suggests early catabolic ADH divergence with subsequent interkingdom gene exchange. The xylF gene, which specifies 2-hydroxymuconic semialdehyde hydrolase (HMSH), was delineated by N-terminal sequence analysis of the purified gene product and is shown to encode a protein of 30.6 kDa. Homology analysis revealed sequence similarity to a chromosomally encoded serine hydrolase, especially in the region of the previously identified active-site serine residue, suggesting that HMSH may also possess a serine hydrolytic enzymatic mechanism. Likewise, the xylJ gene, which specifies 2-hydroxy-pent-2,4-dienoate hydratase (HPH), was delineated by N-terminal sequence analysis of purified HPH, and was found to encode a 23.9 kDa protein. Sequence comparisons revealed that both HMSH and HPH have analogues in the tod gene cluster, which specifies a toluene/benzene degradative pathway. Although the newly identified todF and todJ genes had been at least partially sequenced (Zylstra and Gibson, 1989), the open reading frames had not been positively identified. The presence of todJ provides strong evidence that the reactions following ring fission in the tod pathway are identical to those of the TOL pathway.(ABSTRACT TRUNCATED AT 400 WORDS)
Mol Microbiol 1991 Oct
PMID:DNA sequence determination of the TOL plasmid (pWWO) xylGFJ genes of Pseudomonas putida: implications for the evolution of aromatic catabolism. 179 59

Vertebrate lenses show remarkably taxon-specific patterns of protein composition, most obviously in the recruitment of enzymes as major crystallins. Phylogenetic relationships are particularly apparent in mammals. Here we describe eta-crystallin, which is probably identical to cytosolic aldehyde dehydrogenase, lens-specifically expressed at high abundance in the elephant shrews, primitive eutherians of the family Macroscelidae, and mu-crystallin, a novel lens protein expressed in some marsupials. We have also observed that enzymes that have been recruited as crystallins in some species are also moderately abundant in the lenses of other species. This hints that the origins of enzyme-crystallins may lie in a pool of enzymes widely expressed in lenses at fairly high levels, perhaps because they have important developmental or functional roles in the tissue.
J Mol Evol 1991 Mar
PMID:Lens protein expression in mammals: taxon-specificity and the recruitment of crystallins. 190 3

Methylazoxymethanol (MAM) is the short-lived toxic and carcinogenic aglycone of cycasin, a natural component of the cycad plant. In the present study, the stable acetate ester of MAM, MAM acetate, was tested in combination with porcine liver esterase and Salmonella typhimurium His G46 to study the comparative mutagenicity of this compound in the presence of rat hepatic alcohol dehydrogenase (ADH), aldehyde dehydrogenase (ALDH), and rat liver microsomes. In the presence of rat liver microsomes and an NADPH-generating system, mutagenicity of MAM acetate was not significantly altered. However, addition of rat liver 105,000g supernatant fraction and/or NAD+ significantly increased the number of his+ revertants above control. A concentration-dependent increase in mutagenicity of MAM acetate was observed for NAD+ from 50 to 200 microM, while NADP+ caused a decrease in mutagenicity of MAM acetate in this same concentration range. Pyrazole (100-500 microM) had no significant effect on mutagenicity of MAM acetate in the presence of rat liver 105,000g supernatant, while disulfiram at 500 microM resulted in a significant decrease in mutagenicity of MAM acetate. The results of this study implicate ALDH as essential in activation of MAM acetate to a mutagenic species in this system, while the role of ADH and microsomes appears to be minimal.
Environ Mol Mutagen 1991
PMID:Mutagenicity of methylazoxymethanol acetate in the presence of alcohol dehydrogenase, aldehyde dehydrogenase, and rat liver microsomes in Salmonella typhimurium His G46. 191 9


1 2 3 4 5 6 7 8 9 10 Next >>