Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The proopiomelanocortin (POMC) gene is highly expressed in adult mouse pituitary anterior lobe corticotrophs and intermediate lobe melanotrophs. To identify the DNA elements important for this tissue-specific expression, we analyzed a series of POMC reporter genes in transgenic mice. A DNA fragment containing rat POMC 5'-flanking sequences from -323 to -34 recapitulated both basal pituitary cell-specific and hormonally stimulated expression in adult mice when fused to a heterologous thymidine kinase promoter. Developmental onset of the reporter gene expression lagged by 1 day but otherwise closely paralleled the normal ontogeny of murine POMC gene expression, including corticotroph activation at embryonic day 14.5 (E14.5) followed by melanotroph activation at E15.5 to E16.5. AtT20 corticotroph nuclear protein extracts interacted with three specific regions of the functional POMC promoter in DNase I protection assays. The positions of these protected sites were -107 to -160 (site 1), -182 to -218 (site 2), and -249 to -281 (site 3). Individual deletions of these footprinted sites did not alter transgene expression; however, the simultaneous deletion of sites 2 and 3 prevented transgene expression in both corticotrophs and melanotrophs. Electrophoretic mobility shift and Southwestern (DNA-protein) assays demonstrated that multiple AtT20 nuclear proteins bound to these footprinted sites. We conclude that the sequences between -323 and -34 of the rat POMC gene promoter are both necessary and sufficient for correct spatial, temporal, and hormonally regulated expression in the pituitary gland. Our data suggest that the three footprinted sites within the promoter are functionally interchangeable and act in combination with promoter elements between -114 and -34. The inability of any reporter gene construction to dissociate basal and hormonally stimulated expression suggests that these DNA elements are involved in both of these two characteristics of POMC gene expression in vivo.
Mol Cell Biol 1992 Sep
PMID:Identification of DNA elements cooperatively activating proopiomelanocortin gene expression in the pituitary glands of transgenic mice. 150 98

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.
Mol Cell Biol 1992 Sep
PMID:Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression. 150 12

Fission yeast centromeres vary in size but are organized in a similar fashion. Each consists of two distinct domains, namely, the approximately 15-kilobase (kb) central region (cnt+imr), containing chromosome-specific low copy number sequences, and 20- to 100-kb outer surrounding sequences (otr) with highly repetitive motifs common to all centromeres. The central region consists of an inner asymmetric sequence flanked by inverted repeats that exhibit strict identity with each other. Nucleotide changes in the left repeat are always accompanied with the same changes in the right. The chromatin structure of the central region is unusual. A nucleosomal nuclease digestion pattern formed on unstable plasmids but not on stable chromosome. DNase I hypersensitive sites correlate with the location of tRNA genes in the central region. Autonomously replicating sequences are also present in the central region. The behavior of truncated minichromosomes suggested that the central region is essential, but not sufficient, to confer transmission stability. A portion of the outer repetitive region is also required. A larger outer region is necessary to ensure correct meiotic behavior. Fluorescence in situ hybridization identified individual cens. In the interphase, they cluster near the nuclear periphery. The central sequence (cnt+imr) may play a role in positioning individual chromosomes within the nucleus, whereas the outer regions (otr) may interact with each other to form the higher-order complex structure.
Mol Biol Cell 1992 Jul
PMID:A low copy number central sequence with strict symmetry and unusual chromatin structure in fission yeast centromere. 151 77

The crystal structure of a complex between DNase I and the self-complementary octamer duplex d(GGTATACC)2 has been solved using the molecular replacement method and refined to a crystallographic R-factor of 18.8% for all data between 6.0 and 2.3 A resolution. In contrast to the structure of the DNase I-d(GCGATCGC)2 complex solved previously, the DNA remains uncleaved in the crystal. The general architecture of the two complexes is highly similar. DNase I binds in the minor groove of a right-handed DNA duplex, and to the phosphate backbones on either side over five base-pairs, resulting in a widening of the minor groove and a concurrent bend of the DNA away from the bound enzyme. There is very little change in the structure of the DNase I on binding the substrate. Many other features of the interaction are conserved in the two complexes, in particular the stacking of a deoxyribose group of the DNA onto the side-chain of a tyrosine residue (Y76), which affects the DNA conformation and the binding of an arginine side-chain in the minor groove. Although the structures of the DNA molecules appear at first sight rather similar, detailed analysis reveals some differences that may explain the relative resistance of the d(GGTATACC)2 duplex to cleavage by DNase I: whilst some backbone parameters are characteristic of a B-conformation, the spatial orientation of the base-pairs in the d(GGTATACC)2 duplex is close to that generally observed in A-DNA. These results further support the hypothesis that the minor-groove width and depth and the intrinsic flexibility of DNA are the most important parameters affecting the interaction. The disposition of residues around the scissile phosphate group suggests that two histidine residues, H134 and H252, are involved in catalysis.
J Mol Biol 1992 Aug 20
PMID:X-ray structure of the DNase I-d(GGTATACC)2 complex at 2.3 A resolution. 151 54

Sporamin and beta-amylase are two major proteins of tuberous roots of sweet potato, and expression of genes coding for sporamin and beta-amylase is induced concomitantly in leaves with the petioles attached by exogenous supply of sucrose or polygalacturonic acid. We have used a DNase I footprinting assay to characterize nuclear factors that bind to the 5'-upstream regions of gSPO-A1, gSPO-B1 and g beta-Amy genes that encode A-type sporamin, B-type sporamin and the subunit of beta-amylase, respectively. Nuclear extracts from sucrose-treated petioles protected a region around -155 relative to the transcription start site of gSPO-A1 and a region around -880 of g beta-Amy from DNase I digestion on both strands. These two protected regions both contained the sequence ACTGTGTA, designated SP8a, in opposite orientation with respect to the direction of transcription. A gel mobility shift assay with SP8a oligonucleotide and competition experiments indicated that a common factor SP8BF binds to the SP8a sequence in gSPO-A1 and g beta-Amy. Binding of SP8BF to the SP8a oligonucleotide was abolished by mutation within the SP8a sequence. Fragments of the 5'-upstream region of gSPO-B1 also competed for the binding of SP8BF to the SP8a oligonucleotide, and the DNase I footprinting assay revealed three binding sites for SP8BF in the 5'-upstream region of gSPO-B1. These three sites in gSPO-B1 all contained the sequence TACTATT, designated SP8b, which shared 4 nucleotides at identical positions with the SP8a sequence. An inverted repeat of the SP8b sequence was also present at one protected site in the 5'-upstream region of g beta-Amy. In addition to sucrose-treated petioles, SP8BF activity was also present in tuberous roots and untreated fresh petioles of sweet potato. Furthermore, the activity was also detected in stems of tobacco plantlets, suggesting that SP8BF is an ubiquitous factor.
Plant Mol Biol 1992 Jan
PMID:The nuclear factor SP8BF binds to the 5'-upstream regions of three different genes coding for major proteins of sweet potato tuberous roots. 153 Oct 33

The high level of efficiency of the bacteriophage lambda pL promoter is dependent upon the topological state of the promoter DNA and the binding of a DNA-bending protein, IHF, to a site centered -86 base-pairs upstream from the pL transcription start site. Abortive initiation assays indicate that DNA supercoiling stimulates open complex formation, whereas IHF enhances promoter recognition. IHF stimulates promoter recognition to the same extent on linear and supercoiled templates. We found that the pL region contains a second promoter, pL2, that initiates transcription 42 base-pairs upstream from pL. Although competitive with pL and inhibited by IHF, mutations in pL2 do not affect the regulation of pL. Stimulation by IHF is helix-face-dependent. IHF inhibits pL when the IHF binding site is displaced a helical half-turn upstream. The pL sequences protected against DNase I digestion by bound IHF and RNA polymerase do not overlap. However, DNase I-hypersensitive sites appear in the region between the two bound proteins. In addition, IHF enhances RNA polymerase binding to pL. These data suggest that stimulation of pL by IHF involves the interaction of IHF and RNA polymerase to form a loop or otherwise distort the DNA between their binding sites.
J Mol Biol 1992 Apr 20
PMID:Supercoiling, integration host factor, and a dual promoter system, participate in the control of the bacteriophage lambda pL promoter. 153 52

A DNA plasmid encoding the first 101 amino acid residues of the Xenopus 5 S RNA gene-specific transcription factor IIIA (TFIIIA) was derived by polymerase chain reaction amplification of this region from the cDNA for TFIIIA. This polypeptide includes the first three zinc fingers of the TFIIIA DNA binding domain. The polypeptide was expressed in Escherichia coli and purified to greater than 95% homogeneity. The three finger polypeptide binds the internal control region of the 5 S RNA gene with sequence specificity and high affinity. Binding is metal-dependent and treatment of the polypeptide with EDTA abolishes binding. Polypeptide-DNA complexes exhibit a dissociation constant of 5.6(+/- 0.9) nM, while that for full-length Xenopus TFIIIA is 2.2(+/- 0.4) nM, measured under the same conditions. This suggests that the majority of the free energy of TFIIIA binding resides in these amino-terminal zinc fingers. The polypeptide protects 21 base-pairs of the internal control region from attack by DNase I, with protection from nucleotides +75 to +95 of the 120 base-pair gene. This region includes the C-block promoter element and several guanine residues that are essential for TFIIIA binding. Methylation interference experiments suggest that the mode of binding of the polypeptide and TFIIIA are similar. The minimal DNA sequences required for polypeptide binding were determined using a series of synthetic double-stranded deoxyribo-oligonucleotides. A 13 base-pair oligonucleotide spanning nucleotides +80 to +92 of the 5 S RNA gene retained specific and high-affinity binding, although the latter was reduced sixfold relative to longer DNA fragments. Polypeptides containing fingers 1 and 2, or fingers 2, 3 and 4 of TFIIIA do not exhibit sequence-specific DNA binding. Overall, these studies provide strong support for a model in which the first three zinc fingers of TFIIIA bind with high affinity between nucleotides +80 and +92 of the internal control region of the 5 S RNA gene.
J Mol Biol 1992 Feb 20
PMID:Specific interaction of the first three zinc fingers of TFIIIA with the internal control region of the Xenopus 5 S RNA gene. 153 1

Intracisternal A-type particle (IAP) transcripts are endogenous retrovirus-like sequences expressed during specific stages of normal development and in a variety of murine tumors. In this study, we have analyzed two cell lines derived originally from the SEWA murine osteosarcoma and grown either as ascites or as solid tumors, for proteins that might regulate IAP expression. We found that subline AA7-NA, originally derived from the ascites tumor, expressed about five times more IAP RNA than the AS12-AD subline, which was derived from a solid tumor. In view of this finding, we examined the binding of cellular proteins from the two cell lines to the 5' end of an IAP long terminal repeat sequence. Gel retardation assays of DNA-protein complexes and DNase I footprinting assays identified several DNA sequences within the long terminal repeat fragment that were protected by protein extracts from both SEWA sublines. Gel retardation assays using specific synthetic oligonucleotide sequences that correspond to two of these protected regions revealed different patterns of DNA-protein complexes with extracts from the two SEWA sublines. These data suggest that expression of IAP sequences is regulated by complex mechanisms involving several proteins that appear to differ between the two sublines.
Mol Carcinog 1992
PMID:Interaction of SEWA sarcoma cell proteins with the intracisternal A-type particle long terminal repeat DNA sequence. 154 43

The recent definition of a consensus DNA binding sequence for the Ets family of transcription factors has allowed the identification of potential Ets binding sites in the promoters and enhancers of many inducible T-cell genes. In the studies described in this report, we have identified two potential Ets binding sites, EBS1 and EBS2, which are conserved in both the human and murine interleukin-2 enhancers. Within the human enhancer, these two sites are located within the previously defined DNase I footprints, NFAT-1 and NFIL-2B, respectively. Electrophoretic mobility shift and methylation interference analyses demonstrated that EBS1 and EBS2 are essential for the formation of the NFAT-1 and NFIL-2B nuclear protein complexes. Furthermore, in vitro mutagenesis experiments demonstrated that inducible interleukin-2 enhancer function requires the presence of either EBS1 or EBS2. Two well-characterized Ets family members, Ets-1 and Ets-2, are reciprocally expressed during T-cell activation. Surprisingly, however, neither of these proteins bound in vitro to EBS1 or EBS2. We therefore screened a T-cell cDNA library under low-stringency conditions with a probe from the DNA binding domain of Ets-1 and isolated a novel Ets family member, Elf-1. Elf-1 contains a DNA binding domain that is nearly identical to that of E74, the ecdysone-inducible Drosophila transcription factor required for metamorphosis (hence the name Elf-1, for E74-like factor 1). Elf-1 bound specifically to both EBS1 and EBS2 in electrophoretic mobility shift assays. It also bound to the purine-rich CD3R element from the human immunodeficiency virus type 2 long terminal repeat, which is required for inducible virus expression in response to signalling through the T-cell receptor. Taken together, these results demonstrate that multiple Ets family members with apparently distinct DNA binding specificities regulate differential gene expression in resting and activated T cells.
Mol Cell Biol 1992 Mar
PMID:cis-acting sequences required for inducible interleukin-2 enhancer function bind a novel Ets-related protein, Elf-1. 154 87

The cardiac myosin light chain-2 (MLC-2) gene promoter contains several positive and negative cis-acting sequences that are involved in the regulation of its expression. We describe here the properties of two activator sequences, elements A and P, and their DNA-binding factors (ABFs). Element A (CCAAAAGTGG), located at -61, has homology with the evolutionarily conserved sequence CC(A/T)6GG, present in the genes of many contractile proteins. Element P (TAACCTTGAAAGC), located 114 bp upstream of element A, is conserved in both chicken and rat cardiac MLC-2 gene promoters. Deletion mutagenesis demonstrated that these two elements are involved in the positive regulation of MLC-2 gene transcription. At least two sequence-specific element A-binding proteins, ABF-1 and ABF-2, were identified by gel shift analysis of the fractionated cardiac nuclear proteins. ABF-1 binds to element A with strict dependence on the internal element A sequence AAAAGT. In contrast, ABF-2 exhibits a relaxed sequence requirement, as it recognizes the consensus CArG and CCAAT box sequences as well. ABF-2 also recognizes the distal element P despite the fact that the sequences of elements A and P are divergent. DNase I footprinting, methylation interference, and gel shift analyses demonstrated unequivocally that the element A-DNA affinity-purified protein ABF-2 binds to element P with sequence specificity. Since both elements A and P play a positive regulatory role in MLC-2 gene transcription and bind to a single protein (ABF-2), it would appear that ABF-2 is a key transcription factor with the ability to recognize divergent sequence elements involved in a common regulatory pathway during myogenesis.
Mol Cell Biol 1992 Mar
PMID:A single transcription factor binds to two divergent sequence elements with a common function in cardiac myosin light chain-2 promoter. 154 92


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>