Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

This study extends our analysis of rabbit recombinant Sp17 (rSp17) by examining whether rSp17 synthesized in transfected COS cells will show a particular localization within the cell and whether the COS cell will bind with zona pellucida. We show, using the crosslinking, reagent DSS that rSp17 can bind to rabbit zona glycoprotein R45 or R55.
Mol Reprod Dev 1995 Jan
PMID:Expression of the rabbit sperm protein Sp17 in COS cells and interaction of recombinant Sp17 with the rabbit zona pellucida. 770 69

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.
Mol Biol (Mosk)
PMID:[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]. 824 27

The IGFs have been implicated in the development of the intestinal tract. We have studied the human colon carcinoma cell line CaCo-2 to gain more insight into the function of the IGFs in the gut. [125I]IGF-I and -II bound specifically to CaCo-2 cells as measured in competitive binding experiments. The existence of IGF-I receptors was further demonstrated by affinity crosslinking studies using DSS as the crosslinking agent. Western blotting of CaCo-2 cell extracts using an anti IGF-II/M6P receptor antiserum provided additional evidence for the expression of the IGF-II/M6P receptor. In addition, Northern blotting experiments showed specific IGF-I receptor and IGF-II/M6P receptor gene expression in CaCo-2 cells. An 11 kb band was visualized with a 614 bp PstI IGF-I receptor probe on autoradiographs. Hybridization with a 663 bp IGF-II/M6P receptor probe yielded a 9 kb RNA species. Analysis of CaCo-2 cell RNA using solution hybridization/RNase protection assays yielded two protected fragments, approximately 379 bases in length, with a 394 base IGF-I receptor riboprobe and a 250 base protected fragment with a 260 base IGF-II/M6P receptor riboprobe. In a subset of experiments a PstI 700 base fragment of the IGF-I cDNA and a 554 base SalI fragment of the IGF-II cDNA were used for hybridization: no hybridization was detected with the IGF-I probe. However, using the [32P]IGF-II probe bands at 6.0 and 5.0 kb were labeled in Northern blotting experiments. Analysis of CaCo-2 cell RNA using solution hybridization/RNase protection assays yielded a 289 base protected fragment and a faint 534 base species with a 556 base human IGF-II riboprobe. In addition, IGF-II immunoreactivity was measured in CaCo-2 cell-conditioned medium using an IGF-binding protein blocked radioimmunoassay. CaCo-2 cell-conditioned medium contained 5-15 ng/ml IGF-II immunoreactivity. In conclusion, (1) CaCo-2 cells express both IGF-I receptor mRNA and IGF-II/M6P receptor mRNA and contain functional IGF-I receptor and IGF-II/M6P receptor protein. (2) CaCo-2 cells express IGF-II mRNA and secrete IGF-II immunoreactivity. We hypothesize that in human colon carcinoma cells IGF-II could act as an autocrine growth factor or alternatively could serve as a regulatory factor during differentiation.
Mol Cell Endocrinol 1994 May
PMID:Human colon carcinoma cells (CaCo-2) synthesize IGF-II and express IGF-I receptors and IGF-II/M6P receptors. 939 46

The identification of XY females carrying a duplication of a region of the X chromosome (Xp21) led to the hypothesis that a double dose of a gene in the duplicated region causes sex reversal (DSS; dosage sensitive sex reversal). A gene isolated from this region, named DAX-1 (DSS-AHC critical region on the X), encodes a new member of the nuclear hormone receptor family. Here, we describe the isolation of porcine Dax-1 and the analysis of its pattern of expression both during foetal development and in several adult tissues. Dax-1 is expressed in the adrenals, the pituitary gland and the gonads at various stages of differentiation. In gonads, Dax-1 expression starts between 21 and 23 days post coitum in both XX and XY urogenital ridges then continues to be expressed until adult age. The expression in these tissues indicates the involvement of DAX-1 in the development and the function of the reproductive system at multiple levels.
Mol Cell Endocrinol 1997 Nov 30
PMID:Porcine Dax-1 gene: isolation and expression during gonadal development. 945 40

The rotational spectra of the HSS and DSS radicals were studied in selected regions between 331 and 883 GHz. The radicals were produced by discharging a gaseous mixture of hydrogen (or deuterium) and hydrogen sulfide in the cell. The observation of the b-type Q-branch and R-branch lines with K(a) = 2-1 and 3-2 for HSS and DSS, respectively, as well as the a-type R-branch lines allowed the improvement and the determination of the molecular constants among them (in MHz) We have reevaluated the harmonic force field of HSS and the ground state average and approximate equilibrium structural parameters. For the latter, we obtained r(HS) = 135.23 pm, r(SS) = 196.03 pm, and angle = 101.74 degrees. These results are compared with those from previous and own quantum chemical calculations as well as with results of related molecules. Copyright 2000 Academic Press.
J Mol Spectrosc 2000 Jan
PMID:Rotational Spectra of the Thiosulfeno Radical, HSS and DSS, between 0.3 and 0.9 THz. 1071 72

Germinated barley foodstuff (GBF) contains insoluble protein and dietary fiber, and has the potential to attenuate diarrhea and colonic mucosal damage in colitis. Since GBF contains a poorly digested protein fraction, this protein may be transferred to and absorbed in the colon. It may therefore be possible to detect the GBF antigen in colitis patients with dysfunctional colonic mucosal barrier defense. In this study, the antigenic potency of GBF was examined in vivo and in vitro. Using the AOAC method, the indigestible fraction of GBF (dietary fiber) was obtained, and the poorly digested protein fraction in GBF was determined. Using Sprague Dawley rats with chronic colitis induced by dextran sulfate sodium (DSS, 2.5% in diet), a GBF and control diet were administered, and total and specific serum immunoglobulin E (IgE) against intestinal contents and the soluble GBF protein were determined. In addition, reactivity between serum and intestinal content were examined by gel electrophoresis mobility shift assay (EMSA). GBF showed relatively low protein digestibility (47%) because of its low solubility in neutral pH. Total serum IgE in both dietary groups was not significantly different, and specific IgE antibodies against intestinal contents and the soluble GBF protein were not significantly different. In addition, supershifts were not observed in either dietary group by EMSA. The possible antigenicity of oral GBF was considered to be low in this colitis model.
Int J Mol Med 2001 Feb
PMID:Evaluation of antigenicity of germinated barley foodstuff for the treatment of ulcerative colitis in a chronic murine colitis model. 1117 16

In humans, testis development depends on a regulated genetic hierarchy initiated by the Y-linked SRY gene. Failure of testicular determination results in the condition termed 46,XY gonadal dysgenesis (GD). Several components of the testis determining pathway have recently been identified though it has been difficult to articulate a cascade with the known elements of the system. It seems, however, that early gonadal development is the result of a network of interactions instead of the outcome of a linear cascade. Accumulating evidence shows that testis formation in man is sensitive to gene dosage. Haploinsufficiency of SF1, WT1 and SOX9 is responsible for 46,XY gonadal dysgenesis. Besides, data on SRY is consistent with possible dosage anomalies in certain cases of male to female sex reversal. 46,XY GD due to monosomy of distal 9p and 10q might also be associated with an insufficient gene dosage effect. Duplications of the locus DSS can lead to a failure of testicular development and a duplication of the region containing SOX9 has been implicated in XX sex reversal. Transgenic studies in mouse have shown, however, that this mammal is less sensitive to gene dosage than man. Here, we will try to put in place the known pieces of the jigsaw puzzle that is sex determination in mammals, as far as current knowledge obtained from man and animal models allows. We are certain that from this attempt more questions than answers will arise.
Mol Cell Endocrinol 2001 Jun 20
PMID:Testis determination in mammals: more questions than answers. 1142 Jan 25

The 61 kDa colicin E9 protein toxin enters the cytoplasm of susceptible cells by interacting with outer membrane and periplasmic helper proteins, and kills them by hydrolysing their DNA. The membrane translocation function is located in the N-terminal domain of the colicin, with a key signal sequence being a pentapeptide region that governs the interaction with the helper protein TolB (the TolB box). Previous NMR studies (Collins et al., 2002 J. Mol. Biol. 318, 787-804) have shown that the N-terminal 83 residues of colicin E9, which includes the TolB box, is largely unstructured and highly flexible. In order to further define the properties of this region we have studied a fusion protein containing residues 1-61 of colicin E9 connected to the N-terminus of the E9 DNase by an eight-residue linking sequence. 53 of the expected 58 backbone NH resonances for the first 61 residues and all of the expected 7 backbone NH resonances of the linking sequence were assigned with 3D (1)H-(13)C-(15)N NMR experiments, and the backbone dynamics of these regions investigated through measurement of (1)H-(15)N relaxation properties. Reduced spectral density mapping, extended Lipari-Szabo modelling, and fitting backbone R(2) relaxation rates to a polymer dynamics model identifies three clusters of interacting residues, each containing a tryptophan. Each of these clusters is perturbed by TolB binding to the intact colicin, showing that the significant region for TolB binding extends beyond the recognized five amino acids of the TolB box and demonstrating that the binding epitope for TolB involves a considerable degree of order within an otherwise disordered and flexible domain. Abbreviations : Im9, the immunity protein for colicin E9; E9 DNase, the endonuclease domain of colicin E9; HSQC, heteronuclear single quantum coherence; ppm, parts per million; DSS, 2,2-(dimethylsilyl)propanesulfonic acid; TSP, sodium 3-trimethylsilypropionate; T(1 - 61)-DNase fusion protein, residues 1-61 of colicin E9 connected to the N-terminus of the E9 DNase by an eight residue thrombin cleavage sequence.
...
PMID:Characterisation of a mobile protein-binding epitope in the translocation domain of colicin E9. 1545 37

The orphan nuclear receptor DAX1 (dosage-sensitive sex reversal-AHC critical region on the X chromosome gene 1), encoded by the NR0B1 gene, plays important roles in the development of the hypothalamic-pituitary-adrenal/gonadal (HPAG) axis as well as in sex determination. Mutations in NR0B1 cause the X-linked cytomegalic form of adrenal hypoplasia congenita (AHC), and associated hypogonadotropic hypogonadism (HH). Over-expression of NR0B1 results in sex reversal in mice and duplication of the 160kb DSS locus in human patients results in a sex-reversed phenotype (XY females). The purpose of these investigations was to determine if alternatively spliced forms of NR0B1 existed. Analysis of expressed sequence tag data predicted a truncated isoform of DAX1. We confirmed the presence of an alternatively spliced form of NR0B1, which we will refer to as NR0B1A, by reverse transcriptase-polymerase chain reaction (RT-PCR), and will refer to the deduced protein isoform as DAX1A. Sequencing of the NR0B1A cDNA revealed slight differences from the recently described splice form, DAX1alpha. NR0B1A is encoded by NR0B1 exon 1 and exon 2A located within the 3385 nt intron between NR0B1 exons 1 and 2. Exon 2A includes 35 nt of coding sequence. NR0B1A encodes a deduced protein sequence, DAX1A, of 400 amino acids compared with 470 amino acids for DAX1. RT-PCR detected expression of NR0B1A in adrenal gland, testis, ovary, and pancreas. The identification of NR0B1A and the deduced DAX1A requires reinterpretation of many previous experiments involving expression and knockout of NR0B1 and DAX1.
Mol Genet Metab 2004 Dec
PMID:NR0B1A: an alternatively spliced form of NR0B1. 1558 20

The overproduction of reactive oxygen and nitrogen species (RONS) may play an important role in ulcerative colitis (UC)-associated carcinogenesis. In order to study the role of nitric oxide (NO) in UC-associated colorectal carcinogenesis, the development of colorectal carcinoma was studied using the DSS-induced and iron-enhanced model of chronic UC in inducible nitric oxide synthase (iNOS)-deficient mice. Female wild-type C57BL/6 (iNOS+/+) and iNOS-/- mice were administered 1% DSS (w/v) through the drinking fluid for 15 DSS cycles and fed twofold iron-enriched diet. Colorectal inflammation and mucosal ulceration of moderate severity were observed in both iNOS+/+ and iNOS-/- mice. Similar tumor incidence and multiplicity in the colon were observed that 15 out of 23 (65.2%) iNOS+/+ mice developed colorectal tumors with a tumor multiplicity of 1.47+/-0.17 (mean+/-SE) after 15 DSS cycles, and 13 out of 19 (68.4%) iNOS-/- mice developed colorectal tumors with a tumor multiplicity of 2.08+/-0.21. Histopathologically, the tumors were confirmed to be well-differentiated adenocarcinomas. Nitrotyrosine, an indicator of peroxynitrite-caused protein modification, was detectable by immunohistochemistry in inflammatory cells and epithelial cells of the colon in iNOS+/+ and iNOS-/- mice, and no difference in staining intensity was observed between the two groups. Immunostaining for endothelial NOS (eNOS) was observed in lamina propria macrophages and colonic blood vessels, and eNOS protein levels were increased in the inflamed colon. These results show that there is no difference in UC-associated cancer development in iNOS+/+ and iNOS-/- mice, and suggest that in the absence of iNOS, other factors, such as eNOS, may play a role in nitrosative stress and UC-associated carcinogenesis in this model system.
Mol Carcinog 2007 May
PMID:Colorectal carcinoma development in inducible nitric oxide synthase-deficient mice with dextran sulfate sodium-induced ulcerative colitis. 1721 24


1 2 3 4 5 6 7 8 Next >>