Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Adaptive cardiac hypertrophy in the rat has been characterized as pathological or physiological reflecting the nature of the inciting stimulus. These two adaptations are distinguished by alterations in contractility and in the myosin ATPase composition of the affected muscle. We investigated the relative amounts of the mRNAs encoding cardiac sarcoplasmic reticular calcium ATPase (SERCA2), cardiac and skeletal troponin I (TnI), atrial natriuretic factor (ANF), and myosin light chain 1 (MLC1) in the hearts of rats that had been subjected to either conditioning by swimming (Sw), to renovascular hypertension (H) or to the combined stimulus (H-Sw) for 6 weeks. Compared to control animals, the mRNA levels for SERCA2 and cardiac TnI were slightly increased with Sw and moderately depressed with H. H-Sw animals showed a trend towards normalized mRNA levels for both genes. ANF mRNA levels were slightly elevated with Sw and markedly elevated with both H and H-Sw. MLC1 mRNA levels did not change with either or both stimuli. These data confirm that these two types of adaptive hypertrophy can be distinguished at the level of gene expression and suggest that the mechanical alterations seen in adaptive hypertrophy reflect a spectrum of pre-translational alterations which are not limited to changes in myosin heavy chain gene expression.
J Mol Cell Cardiol 1994 Jan
PMID:Alterations in gene expression in the rat heart after chronic pathological and physiological loads. 819 70

Calmodulin (CaM) is the primary Ca2+ regulatory protein in cardiac cells, thus alterations in calmodulin would greatly influence the contractile response and may play a role in the abnormal calcium handling observed in human heart failure. We used Northern blot analysis to determine changes in calmodulin mRNA expression in left ventricular tissues isolated from 20 failing and four control human hearts. Only hearts with failure due to idiopathic dilated cardiomyopathy (DCM) or ischaemic heart disease (IHD) were studied. A human calmodulin cDNA probe 95% homologous to Type 3 CaM was used, which hybridized to a single 2.3 kb mRNA. CaM mRNA levels were expressed as a function of total RNA, as determined by hybridization to an 18S cDNA probe, and as a function of myocyte specific mRNA, as determined by hybridization to a myosin heavy chain (MHC) cDNA probe. In both DCM and IHD, CaM mRNA expression relative to total RNA (CaM/18S), was significantly decreased (45% and 61%, respectively) compared to control hearts. CaM mRNA expression in DCM tissues was also significantly decreased (45%) relative to myocyte specific mRNA (CaM/MHC), when compared to control hearts. In IHD, CaM mRNA was not significantly decreased in relation to myocyte specific mRNA, which suggests a greater loss of myocytes or contractile proteins in IHD as compared with DCM. The decreased expressed of CaM mRNA observed in failing hearts could affect many Ca(2+)-dependent processes, and contribute to the inability of these hearts to handle Ca2+ in a viable manner.
J Mol Cell Cardiol 1994 Jan
PMID:Decreased expression of calmodulin mRNA in human end-stage heart failure. 819 73

Serial deletion constructs derived from the 5'-flanking regions of the human cardiac alpha- and beta-myosin heavy chain genes were generated by polymerase chain reaction (PCR) amplifications. Generation of different length chimeric constructs were based on the complete sequence of the human cardiac myosin heavy chain genes. The primers were synthesized with HindIII and BamH1 sites and were linked to any designed nucleotide of the 5' flanking sequence of the myosin heavy chain gene(s). Following the PCR amplification and the site-directed mutagenesis, the PCR products were verified by DNA sequencing and subsequently ligated to the chloramphenicol acetyltransferase (pBLCAT3) reporter gene which was restricted with Hind III and BamH1. Neonatal rat cardiocytes were used to assay the promotor activity (i.e. CAT activity) of different lengths of the chimeric constructs of the gene.
Mol Cell Biochem 1993 Jul 07
PMID:Serial deletion constructs of human cardiac myosin heavy chain genes generated by PCR amplification. 823 79

Recent work on molecular genetics of mammalian contractile proteins has provided valuable insights into the basis of the heterogeneity of muscle proteins and their regulated expression during development, yet information on the precise role(s) of light chains in actomyosin interaction and muscle function is still lacking. The selective increase in ventricular myosin light chain-2 (MLC2) in hypertrophied heart muscle has been implicated as a compensatory feature of myosin, but its relevance to myosin function is not known. To investigate the role of cardiac MLC2, we have isolated a full-length cDNA clone for human ventricular MLC2 and produced a full-length and N-terminal deleted MLC2 polypeptides in Escherichia coli using the bacterial expression vector pT7-7 system. The interaction of recombinant MLC2 with myosin heavy chain (MHC) and its subfragment-1 was studied using the full-length and truncated recombinant polypeptides. The results demonstrated that the bacterially produced full-length human cardiac MLC2 exchanges effectively with the native MLC2 and binds with specificity to MHC and to intact myofibrils. Domain mapping by deletion and in vitro exchange/competition analysis with a synthetic peptide suggests that a conserved central domain in MLC2 participates in the functional association of the two myosin subunits.
Cell Mol Biol Res 1993
PMID:Interaction of a conserved peptide domain in recombinant human ventricular myosin light chain-2 with myosin heavy chain. 828 67

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site. 829 96

Skeletal muscle myosin cDNAs were expressed in a simian kidney cell line (COS) and a mouse myogenic cell line to investigate the mechanisms controlling early stages of myosin filament assembly. An embryonic chicken muscle myosin heavy chain (MHC) cDNA was linked to constitutive promoters from adenovirus or SV40 and transiently expressed in COS cells. These cells accumulate hybrid myosin molecules composed of muscle MHCs and endogenous, nonmuscle, myosin light chains. The muscle myosin is found associated with a Triton insoluble fraction from extracts of the COS cells by immunoprecipitation and is detected in 2.4 +/- 0.8-micron-long filamentous structures distributed throughout the cytoplasm by immunofluorescence microscopy. These structures are shown by immunoelectron microscopy to correspond to loosely organized bundles of 12-16-nm-diameter myosin filaments. The muscle and nonmuscle MHCs are segregated in the transfected cells; the endogenous nonmuscle myosin displays a normal distribution pattern along stress fibers and does not colocalize with the muscle myosin filament bundles. A similar assembly pattern and distribution are observed for expression of the muscle MHC in a myogenic cell line. The myosin assembles into filament bundles, 1.5 +/- 0.6 micron in length, that are distributed throughout the cytoplasm of the undifferentiated myoblasts and segregated from the endogenous nonmuscle myosin. In both cell lines, formation of the myosin filament bundles is dependent on the accumulation of the protein. In contrast to these results, the expression of a truncated MHC that lacks much of the rod domain produces an assembly deficient molecule. The truncated MHC is diffusely distributed throughout the cytoplasm and not associated with cellular stress fibers. These results establish that the information necessary for the segregation of myosin isotypes into distinct cellular structures is contained within the primary structure of the MHC and that other factors are not required to establish this distribution.
Mol Biol Cell 1993 Oct
PMID:Segregated assembly of muscle myosin expressed in nonmuscle cells. 829 91

Both genetically determined and artificially-induced hypertension lead to cardiac hypertrophy and shift the myosin heavy chain (MHC) expression to the beta-MHC form. The cause of this change in gene expression is unknown. To contribute to the understanding of this phenomenon, we correlated the MHC expression in the left ventricle with basal, Forskolin- and isoprenaline-stimulated adenylate cyclase activity (cAMP production of membrane fractions). We used two control rat strains [Wistar-Hagemann (WH), Wistar-Kyoto (WKY)] and several rat models of hypertension: one clip-one kidney (1C-1K), desoxycorticosterone-treated rats (DOCA), rats with reduced renal mass (RRM) and spontaneously hypertensive rats (SHR). The level of hypertension correlated positively with the degree of cardiac hypertrophy (P < 0.01) and negatively (P < 0.05) with cAMP production, e.g. the higher the degree of hypertension, the lower both basal and stimulated cAMP levels. In addition we found that the lower the basal, isoprenaline- and Forskolin-stimulated cAMP production the lower was the expression of the alpha-MHC isoenzyme (P < 0.05). Thus, our data suggest that the decreased alpha-MHC expression upon hypertension-induced cardiac hypertrophy could be mediated via decreased adenylate cyclase activity and thus decreased intracellular cAMP production.
J Mol Cell Cardiol 1993 Apr
PMID:Correlation of myosin heavy chain expression in the rat with cAMP in different models of hypertension-induced cardiac hypertrophy. 839 91

The C-terminal 24-kDa fragment of myosin subfragment-1 (S-1) heavy chain was isolated by papain digestion of porcine aorta myosin followed by ethanol fractionation. The isolated 24-kDa fragment was digested by lysylendopeptidase. When the digest was ultracentrifuged with F-actin, 7- and 2-kDa peptides coprecipitated with the actin. These two peptides were isolated by high performance liquid chromatography, and their amino acid sequences were determined. The 7- and 2-kDa peptides correspond to residues 692-744 and 835-846, respectively, of the chicken gizzard myosin heavy chain (Yanagisawa, M., Hamada, Y., Katsuragawa, Y., Imamura, M., Mikawa, T., and Masaki, T. (1987) J. Mol. Biol. 198, 143-157). The 7-kDa peptide contains the reactive cysteine residues, SH1 and SH2. The isolated 7- and 2-kDa peptides also bound to F-actin with dissociation constants of 0.6 and 12 microM, respectively. The 2-kDa peptide was found to compete with rabbit skeletal S-1 for the binding to F-actin by examining the binding of S-1 to actin in the presence of various concentrations of the 2-kDa peptide. The 2-kDa peptide was also shown to interact with the regulatory light chain of aorta myosin by difference UV absorption spectroscopy. The 2-kDa peptide inhibited the actin-activated ATPase activity of skeletal S-1, and the inhibition was canceled by the addition of the isolated regulatory light chain. These results suggest that the newly found 2-kDa peptide region may be related to the regulation of smooth muscle actomyosin ATPase activity by phosphorylation of the regulatory light chain.
...
PMID:Actin-binding peptides obtained from the C-terminal 24-kDa fragment of porcine aorta smooth muscle myosin subfragment-1 heavy chain. 842 12

We determined the steady-state level of mRNA for myosin heavy chain (MHC) from airway smooth muscle during maturation in domestic swine. Tissues were excised, and airway smooth muscle was dissected from three neonatal (NEO), three 2-wk-old swine (2ws), three 10-wk-old swine (10ws), and three adult swine. Total RNA was isolated, fractionated, and transferred to a nitrocellulose membrane (Northern blot). A single-stranded oligonucleotide of 63-nt was synthesized corresponding to the 3' coding region of the chicken gizzard MHC cDNA. This region appeared to be highly conserved (92% nucleotide sequence homology with the corresponding portion of rabbit uterine smooth muscle MHC cDNA). Northern blots, which were loaded with equivalent quantities of total RNA, were probed with gamma 32P-labeled synthetic oligonucleotide, and, under stringent washing conditions, the 5' end-labeled DNA was hybridized to a single band of the expected molecular weight. The mRNA for total myosin was quantified using autoradiograms of blots, and signal intensity was measured as integrated areas expressed as arbitrary densitometric units x mm (AU). The content of mRNA for MHC was substantially greater in NEO than in more mature animals; maximal area was 1.33 +/- 0.15 AU for NEO, 0.33 +/- 0.05 AU for 2ws, 0.30 +/- 0.04 AU for 10ws, and 0.34 +/- 0.08 AU for adult swine (P < 0.05, NEO versus 2ws, 10ws, and adult). Rehybridization of each blot with a 28S ribosomal RNA probe confirmed comparable total RNA loadings for all tissue samples.(ABSTRACT TRUNCATED AT 250 WORDS)
Am J Respir Cell Mol Biol 1993 Mar
PMID:Changes in levels of mRNA encoding myosin heavy chain in porcine trachealis during ontogenesis. 844 16

Seven Mabs prepared against subfragment 1 (S1) of either bovine cardiac beta-specific or rabbit fast skeletal muscle myosin were used to identify functional regions in cardiac isomyosin heavy chains. This approach was designed to improve the understanding of structure-function relationships within the myosin molecule and between alpha and beta myosin heavy chains (MHCs). We used bacterial expression of human beta myosin fragments and determined that the seven antibodies were localized within four different MHC subdomains: amino acid residues 33-37 (one beta-specific antibody), 67-84 (one alpha/beta-specific antibody), 85-106 (four alpha/beta-specific antibodies) and 215-248 (one alpha/beta-specific antibody). All epitopes were accessible on myosin and actomyosin with the same affinities. Therefore, none of these MHC epitopes were located on the interfaces between the myosin head and actin. Three antibodies reacting at three out of the four investigated epitopes enhanced acto-S1 ATPase activities but not myosin, S1, or actomyosin activities. One antibody, which was strictly beta-specific and bound to five amino acid residues near the most N-terminal MHC end, substantially inhibited all myosin or S1 ATPase activities measured with or without actin. The epitope of this antibody coincides with one difference cluster observed between both cardiac MHC isoforms [McNally et al (1989) J. Mol. Biol. 210, 665-671], suggesting that this small variable MHC area could be one of the structural bases to explain observed functional differences in cardiac alpha and beta myosin isoforms.
...
PMID:Probing functional regions in cardiac isomyosins with monoclonal antibodies. 844 13


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>