Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The early proteins of simian virus 40 (SV40) large T and small t antigen (T/t antigen) can each cause the transcriptional activation of a variety of cellular and viral promoters. We showed previously that simian cellular DNA-binding factors (the Band A factors) bind to sequences within the SV40 late promoter which are important for transcriptional activation in the presence of the SV40 early proteins. Band A factors isolated from simian cells which produce T/t antigen (COS cells or SV40-infected CV-1 cells) have altered binding properties in comparison with the factors from normal simian cells (CV-1). This suggests that the transcriptional activation mediated by T/t antigen may be due to either modification of existing factors or induction of new members of a family of factors. We have purified the Band A factors from both COS and CV-1 cells and have determined the binding site by methylation interference and DNase protection footprinting. The COS cell factors have altered chromatographic properties on ion-exchange columns and have higher-molecular-weight forms than the CV-1 cell factors. Major forms of the CV-1 factors migrate between 20 and 24 kilodaltons, while the COS factors migrate between 20 and 28 kilodaltons. The binding sites for the factors from CV-1 and COS cells are similar, covering a rather broad region within the 72-base-pair repeat comprising the AP-1 site and the two-octamer binding protein (OBP100/Oct 1) sites, OBP I and OBP II. Specific binding competition analyses indicate that the two general regions within the binding site (the AP-1-OBP II site and the OBP I site) each retain partial binding ability; however, the factors bind best when the two regions are adjacent in a relatively specific spatial arrangement. The binding site for the Band A factors corresponds very well to sequences necessary for the activation of the late promoter as defined by deletion and base substitution mutagenesis studies (J. M. Keller and J. C. Alwine, Mol. Cell. Biol. 5:1859-1869, 1985; E. May, F. Omilli, M. Emoult-Lange, M. Zenke, and P. Chambon, Nucleic Acids Res. 15:2445-2461, 1987). These data, in combination with the data showing that the Band A factors are modified or induced in the presence of T/t antigen, strongly suggest that T/t antigen mediates its transcriptional activation function, at least in part, through the Band A factors.
 ...
PMID:Activity of simian DNA-binding factors is altered in the presence of simian virus 40 (SV40) early proteins: characterization of factors binding to elements involved in activation of the SV40 late promoter. 215 10

The cell-specific regulation of DNA replication has important implications for the molecular strategy of cellular gene control. Mouse polyomavirus (Py) DNA replication is examined as a model of cell-specific replication control. Using an FM3A-derived mouse cell line which expresses early viral proteins (FOP cells), we determined the minimal sequence requirements for viral DNA replication. FOP cells were observed to have much simpler enhancer requirements than 3T6 and many other cells and did not need a B enhancer for high levels of DNA replication. Using these cells, we show that the individual or tandem binding sites for several unrelated trans-acting factors which are generally subfunctional as transcriptional enhancers (simian virus 40 A core, TGTGGAATG; EBP20, TGTGGTTTT; PEA1 [an AP-1 analog], GTGACTAA; PEA2, GACCGCAG; and PEA3, AGGAAG) stimulated low levels of Py DNA replication. The ordered dimeric combination of PEA3 and PEA1 factor-binding sites, however, acted synergistically to stimulate viral DNA replication to high wild-type levels. This is in contrast to prior results in which much larger enhancer sequences were necessary for high-level viral DNA replication. PEA3/PEA1-stimulated DNA replication showed a distance and orientation independence relative to the origin, which disagrees with some but not other prior analyses of enhancer-dependent DNA replication. It therefore appears that trans-acting factor-binding sites (enhansons) can generally activate DNA replication and that the AP-1 family of sites may act synergistically with other associated trans-acting factors to strongly affect Py DNA replication in specific cells.
Mol Cell Biol 1990 Sep
PMID:Minimal subenhancer requirements for high-level polyomavirus DNA replication: a cell-specific synergy of PEA3 and PEA1 sites. 216 44

The adenovirus early region 1A (E1A) oncogene interferes with the expression level and activity of the AP-1 transcription factor family. E1A abolished the transactivating function of AP-1 (Jun/Fos), which binds to the 12-O-tetradecanoylphorbol-13-acetate-responsive element of the collagenase gene (collTRE). In contrast, the activity of another member of the AP-1 family that binds to the c-junTRE was not repressed. The mRNA expression of the c-jun gene was, in fact, strongly elevated in various cell types expressing the E1A gene of either adenovirus type 5 (Ad5) or Ad12. The regulation of the junB gene by adenovirus E1A, on the other hand, depended both on the cell type and on the transforming adenovirus serotype. The fact that E1A-induced alterations in the repertoire of AP-1 transcription factors depend on its transforming domain in conserved region 1 suggests that the effects are relevant for the transformation process.
Mol Cell Biol 1990 Nov
PMID:Differential effects of the adenovirus E1A oncogene on members of the AP-1 transcription factor family. 217 87

The macrophage-derived cytokine interleukin-1 (IL-1) can provide a second signal with antigen to elicit production of interleukin-2 (IL-2) by helper T cells. The pathway(s) involved remains controversial, with protein kinase C and cyclic AMP (cAMP) invoked as possible second messengers. In the murine thymoma EL4.E1, IL-1 could synergize with the phosphoinositide pathway, because the cells made higher levels of IL-2 in the presence of IL-1 than could be induced by phorbol ester plus calcium ionophore alone. IL-1 is unlikely to act through a sustained increase in cAMP in these cells because it did not raise cAMP levels detectably and because IL-1 and forskolin had opposite effects on IL-2 gene expression. Inducible expression of a transfected reporter gene linked to a cloned fragment of the murine IL-2 gene promoter was initially increased by IL-1 costimulation, implying that IL-1 can increase the rate of transcription of IL-2. The minimal promoter elements required for iL-1 responsiveness were located within 321 bp of the IL-2 RNA cap site, and further upstream sequences to -2800 did not modify this response. IL-1 costimulation resulted in enhanced activity of both an inducible NF-kappa B-like factor and one of two distinct AP-1-like factors that bind to IL-2 regulatory sequences. Neither was induced, however, by IL-1 alone. Another AP-1-like factor and NFAT-1, while inducible in other cell types, were expressed constitutively in the EL4.E1 cells and were unaffected by IL-1. These results are discussed in terms of the combinatorial logic of IL-2 gene expression.
Mol Cell Biol 1990 Dec
PMID:Interleukin-1 synergy with phosphoinositide pathway agonists for induction of interleukin-2 gene expression: molecular basis of costimulation. 217 6

Proteolysis by type IV collagenase (T4) has been implicated in the process of tumor metastasis. The T4 gene is expressed in fibroblasts, but not in normal epithelial cells, and its expression is specifically repressed by the E1A oncogene of adenovirus. We present an investigation of the transcriptional elements responsible for basal, E1A-repressible, and tissue-specific expression. 5'-Deletion analysis, DNase I footprinting, and gel mobility shift assays revealed a strong, E1A-repressible enhancer element, r2, located about 1,650 bp upstream of the start site. This enhancer bound a protein with binding specificity very similar to that of the transcription factor AP-2. A potent silencer sequence was found 2 to 5 bp downstream of this enhancer. The silencer repressed transcription from either r2 or AP-1 enhancer elements and in the context of either type IV collagenase or thymidine kinase (tk) gene core promoters; enhancerless transcription from the latter core promoter was also repressed. Comprising the silencer were two contiguous, autonomously functioning silencer elements. Negative regulation of T4 transcription by at least two factors was demonstrated. mcf-7 proteins specifically binding both elements were detected by gel mobility shift assays; a protein of approximately 185 kDa that bound to one of these elements was detected by DNA-protein cross-linking. The silencer repressed transcription, in an r2 enhancer-tk promoter context, much more efficiently in T4-nonproducing cells (mcf-7 or HeLa) than in T4-producing cells (HT1080), suggesting that cell type-specific silencing may contribute to the regulation of this gene.
Mol Cell Biol 1990 Dec
PMID:Positive and negative transcriptional elements of the human type IV collagenase gene. 217 9

The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined.
Mol Cell Biol 1990 Nov
PMID:Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes. 223 10

We have performed transfection and DNase I footprinting experiments to investigate pituitary-specific expression of the human prolactin (hPRL) gene. When fused to the chloramphenicol acetyltransferase (CAT) reporter gene, 5,000 base pairs of the 5'-flanking sequences of the hPRL gene were able to drive high cat gene expression in prolactin-expressing GH3B6 cells specifically. Deletion analysis indicated that this pituitary-specific expression was controlled by three main positive regulatory regions. The first was located just upstream from the TATA box between coordinates -40 and -250 (proximal region). We have previously shown that three motifs of this region bind the pituitary-specific Pit-1 factor. The second positive region was located in the vicinity of coordinates -1300 to -1750 (distal region). DNase I footprinting assays revealed that eight DNA motifs of this distal region bound protein Pit-1 and that two other motifs were recognized by ubiquitous factors, one of which seems to belong to the AP-1 (jun) family. The third positive region was located further upstream, between -3500 and -5000 (superdistal region). This region appears to enhance transcription only in the presence of the distal region.
Mol Cell Biol 1990 Sep
PMID:Regulatory elements controlling pituitary-specific expression of the human prolactin gene. 2388 22

A group of five cDNA clones, representing the gadd genes, were recently isolated from Chinese hamster ovary (CHO) cells as genes induced upon growth arrest and after DNA damage (Fornace, A. J., Jr., Nebert, D. W., Hollander, M. C., Luethy, J. D., Papathanasiou, M., Fargnoli, J., and Holbrook, N. J. (1989) Mol. Cell. Biol. 9, 4196-4203). We have isolated and characterized one of these genes, gadd153. The gene spans five kilobases and contains four exons. The 5'-flanking region of the gene, within 420 base pairs of the transcription initiation site, contains a number of cis elements associated with transcriptional regulation in other genes. These include a Hogness box, ATAAAA, an inverted GCCAAT box; seven SP1 transcription factor binding sites, and an AP-1 site. This region is rich in G + C content (greater than 70%) and contains an unusually long stretch of alternating CpG residues. The 800-base pair region immediately upstream of the transcription start site can drive expression of the bacterial chloramphenicol acetyltransferase (CAT) gene, but only in its endogenous orientation, in three different cell lines: HeLa, CHO, and Jurkat. The gadd153 promoter is strongly activated by methyl methanesulfonate, hydrogen peroxide, and UV irradiation, but not by growth arrest signals. This suggests that separate and very different regulatory pathways are involved in the induction of the gadd153 gene by growth cessation and DNA damage.
 ...
PMID:Isolation and characterization of the hamster gadd153 gene. Activation of promoter activity by agents that damage DNA. 239 62

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.
Mol Cell Biol 1990 Oct
PMID:DNA-binding protein activated by gamma radiation in human cells. 239 92

Rat pheochromocytoma PC12 cells differentiate to sympathetic neuron-like cells upon treatment with nerve growth factor (NGF). The ras and src transforming proteins also induce PC12 neuronal differentiation and are likely to involve the protein kinase C signal transduction pathway. Using a number of ras mutants, we have established that the domains of oncogenic ras protein responsible for PC12 differentiation overlap those required for cellular transformation. All of the ras mutants that induced neuronal differentiation also activated c-fos transcription through the dyad symmetry element (DSE). Transforming ras protein activated an intracellular signal pathway, which led to the induction of 12-O-tetradecanoyl phorbol-13-acetate-responsive elements; activation was enhanced by coexpression of the proto-oncogene jun (encoding AP-1) and was further augmented by fos. Nuclear extracts from ras-infected PC12 cells showed an increased AP-1 DNA-binding activity. Transcriptional activation by ras was independent of the cyclic AMP-dependent pathway of signal transduction. We propose a possible involvement of fos and jun in ras-induced differentiation.
Mol Cell Biol 1989 Aug
PMID:ras-induced neuronal differentiation of PC12 cells: possible involvement of fos and jun. 250 2


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>