Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the
AP-1
, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.
Mol
Cell Biol 1992 Sep
PMID:Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression. 150 12
The activity of
AP-1
, a trans-acting transcription factor, is stimulated by 12-O-tetradecanoylphorbol-13-acetate (TPA) and epidermal growth factor (EGF) in promotion-sensitive (P+) but not in promotion-resistant (P-) JB6 mouse epidermal cell lines. TPA and EGF also promote neoplastic transformation only in P+ cells. Thus, it has been proposed that
AP-1
-dependent gene expression is involved in determining sensitivity to tumor promotion. This paper explores the possible basis for the differential inducibility of
AP-1
activity in P+ and P- JB6 cells, focusing in particular on the regulation of expression of the components of the
AP-1
complex at the mRNA level. The expression of jun and fos gene family members, which make up the
AP-1
complex, can be stimulated by serum and a number of growth factors, including EGF, and by TPA. Therefore, the possibility that differential expression of one or more forms of jun or fos contributes to the differential
AP-1
activity was considered. The data presented here demonstrate both similarities and differences in the basal and TPA- or EGF-induced levels of fos and jun family members between P+ and P- cells. The most striking observation was that the overall TPA- and EGF-induced levels of jun but not fos expression were higher in P+ cells. This suggests that tumor promoter-regulated c-jun expression may contribute to the differential
AP-1
activation observed in these cells and may be important in determining sensitivity to promotion of neoplastic transformation.
Mol
Carcinog 1992
PMID:Differential c-jun expression in response to tumor promoters in JB6 cells sensitive or resistant to neoplastic transformation. 154 42
The tumor promoters phorbol esters are thought to induce changes in cell growth and gene expression by direct activation of protein kinase C (PKC). However, the molecular mechanisms by which PKC molecules transduce signals into the cell nucleus are unknown. In this study, we provide evidence for a direct target for phorbol esters in the nucleus. We demonstrate that the new PKC-related family member, PKC-L, recently isolated by us, is expressed specifically in the cell nucleus. Localization of PKC-L in the cell nucleus is shown both by immunofluorescence staining and by subcellular fractionation experiments of several human cell lines, including the human epidermoid carcinoma line A431. Treatment of these cells by phorbol esters does not induce the down-regulation of PKC-L, in contrast to their effect on classical PKC family members. This is the only PKC isoenzyme described so far that resides permanently and specifically in the cell nucleus. PKC-L may function as an important link in tumor promoting, e.g., as a nuclear regulator of gene expression that changes the phosphorylation state of transcriptional components such as the
AP-1
complex.
Mol
Cell Biol 1992 Mar
PMID:The protein kinase C-related PKC-L(eta) gene product is localized in the cell nucleus. 154 11
The CEF-4/9E3 gene is expressed constitutively in Rous sarcoma virus (RSV)-transformed cells. This expression is largely determined by an increase in transcription of the gene. In this report, we characterize the regulatory elements responsible for the transformation-dependent activation of CEF-4/9E3. Three sequences corresponding to
AP-1
, PRD II/kappa B, and TAACGCAATT are involved in the process and therefore define the src-responsive unit (SRU) of the CEF-4 promoter. In constructs containing a deletion of the SRU, multiple copies of
AP-1
or PRD II/kappa B, but not TAACGCAATT, led to activation of the promoter. Thus, factors interacting with these elements are constitutively activated in RSV-transformed chicken embryo fibroblasts. In agreement with the results of transient expression assays, protein binding to
AP-1
, PRD II/kappa B, and TAACGCAATT were more abundant in the nuclei of transformed cells. The expression of the CEF-4 promoter was investigated in cells infected by a temperature-sensitive mutant of RSV. No significant increase in CEF-4 promoter activity was detected early after activation of pp60v-src. In contrast, a substantial activation of the CEF-4 promoter was detected late after a temperature shift. Factors interacting with the TAACGCAATT, PRD II/kappa B, and
AP-1
elements accumulated gradually over a period of several hours. Therefore, transcriptional activation plays an important role in the late, constitutive expression of the CEF-4 gene in stably transformed cells.
Mol
Cell Biol 1992 Apr
PMID:Transcriptional activation of the CEF-4/9E3 cytokine gene by pp60v-src. 154 6
A major regulatory element required for expression of the human alpha-globin genes is located 40 kb upstream of the embryonic zeta-globin gene. To understand how this and other locus control region (LCR) elements contribute to high-level expression in erythroid cells, we have performed high-resolution, in vivo dimethyl sulfate footprinting. In addition, we have modified the dimethyl sulfate-based ligation-mediated polymerase chain reaction in vivo footprinting procedure to permit the assessment of interactions at guanine and adenine residues, rather than guanines alone. In vivo footprinting of the human alpha-LCR element carried on chromosome 16 in a mouse erythroleukemia cell environment revealed protein occupancy at GATA-1,
AP-1
/NF-E2, and CACC/GGTGG motifs, specific differences compared with in vitro protein binding, and distinct changes in one region upon dimethyl sulfoxide-induced cellular maturation. No protein contacts were detected in nonexpressing hepatoma cells. In addition, we have demonstrated that two
AP-1
motifs in the alpha-LCR element which are occupied in vivo bind purified mouse NF-E2 protein in vitro. Our data suggest that three proteins, GATA-1, NF-E2, and unknown CACC/GGTGG factors, are minimally required as DNA-binding proteins for the function of LCR-like elements. The juxtaposition and interaction of these factors with each other, and with accessory proteins not directly in contact with DNA, are likely to account for the relative position independence of the upstream globin regulatory elements.
Mol
Cell Biol 1992 May
PMID:In vivo footprinting of the human alpha-globin locus upstream regulatory element by guanine and adenine ligation-mediated polymerase chain reaction. 156 44
The X box in the DRA promoter of the human histocompatibility complex is required for expression of the DRA gene in B cells. We show that a B-cell factor binds to a sequence that is clearly distinguishable from binding sites for the previously described X box binding nuclear proteins RF-X, NF-X, NF-Xc, NF-S, hXBP, and
AP-1
. Mutations in the DRA X box that disrupt the binding of this factor result in a lower level of gene expression, as does the presence of Id (a trans-dominant regulatory protein that negatively regulates helix-loop-helix proteins). Furthermore, this factor is recognized by antibodies directed against the helix-loop-helix protein A1, a mouse homolog of the immunoglobulin enhancer binding proteins E12/E47, and it binds to sequences in other genes that were previously shown to bind these proteins. By these criteria, this factor is BCF-1.
Mol
Cell Biol 1992 May
PMID:B-cell factor 1 is required for optimal expression of the DRA promoter in B cells. 156 56
The VL30 family of defective murine retroviruses consists of 100 to 200 members, of which fewer than 5% appear to be transcriptionally active. A genomic clone of the transcriptionally active VL30 element RVL-3 was identified and sequenced. Genetic analysis indicated that a triple-repeat sequence within the RVL-3 long terminal repeat is capable of functioning as an inducible enhancer element responding to a variety of agonists. In Rat-1 fibroblasts, the ability of the RVL-3 enhancer to mediate induction of gene expression from a heterologous promoter in response to either epidermal growth factor (EGF) or phorbol ester treatment required coelevation of intracellular calcium. Two CArG boxes present in the triple-repeat sequence appeared to exert a negative effect on gene expression, as mutation of these sequences elevated the basal level of expression observed without altering the fold induction in response to either EGF or protein kinase C activation. In the presence of these CArG elements, mutation of
AP-1
-like sites adjacent to the CArG elements significantly inhibited the ability of either EGF or phorbol esters to induce gene expression. The effect of mutating these
AP-1
-like sites was relieved by simultaneous mutation of the CArG sites, indicating that interactions among these sites modulate RVL-3 expression. Mutational analysis and gel mobility shift experiments have identified a third sequence within the VL30 triple-repeat element that is required for the induction of gene expression and serves as a binding site for nuclear proteins. Sequence comparisons indicate that this enhancer element has not been described previously.
Mol
Cell Biol 1992 Jun
PMID:Identification of a novel enhancer element mediating calcium-dependent induction of gene expression in response to either epidermal growth factor or activation of protein kinase C. 158 71
The major histocompatibility complex (MHC) class I HLA-B7 transgene carrying a 660-bp upstream sequence is expressed in the mouse with tissue specificity that parallels that of the expression of endogenous mouse MHC class I (H-2) genes. We have performed in vivo genomic footprinting for the HLA-B7 transgene and the endogenous H-2Kb gene. We show that the upstream region of both the transgene and the endogenous gene was extensively occupied in spleen tissue, where these genes are expressed at high levels. In contrast, no occupancy was detected in brain tissue, where expression of these genes is virtually absent. Sites exhibiting in vivo protection correspond to cis elements previously shown to bind to nuclear factors in vitro, including the constitutive enhancer region I and the interferon response element. The strongest tissue-specific protection was detected at site alpha, located downstream from the interferon response element. Site alpha bound a constitutively expressed nuclear factor(s) in vitro that exhibited an overlapping specificity which may involve a nuclear hormone receptor, RXR, and an
AP-1
-related factor. Site alpha was functional in vivo, as it enhanced MHC class I transcription in lymphocytes. These results show that the tissue-specific occupancy of the MHC class I regulatory sequences in vivo correlates with their expression and suggest that in vivo occupancy is controlled by a mechanism other than the mere presence of factors capable of binding to these sites. Our results suggest that a sequence present in the 660-bp upstream region in a human leukocyte antigen gene directs tissue-specific occupancy of MHC class I genes in vivo, independently of their position and copy number, illustrating a potential advantage of using a transgene for delimitation of the sequence requirement for in vivo occupancy.
Mol
Cell Biol 1992 Aug
PMID:Occupancy of upstream regulatory sites in vivo coincides with major histocompatibility complex class I gene expression in mouse tissues. 163 Apr 63
Stromelysin gene expression is transcriptionally activated by a number of growth factors (e.g., EGF and PDGF), tumor promoters (e.g., TPA), and oncogenes (e.g., ras, src) through an
AP-1
-dependent mechanism. TGF-beta repression of stromelysin induction is mediated at the level of transcription by an element located at position -709 in the rat stromelysin promoter referred to as the TGF-beta inhibitory element (TIE). A TIE-binding protein complex is induced by treatment of rat fibroblasts with TGF-beta. This protein complex contains the protooncogene c-fos, and induction of c-fos by TGF-beta is required for the repressive effects of TGF-beta on stromelysin gene expression. Interestingly, c-fos induction is also required for stimulation of stromelysin expression by EGF in rat fibroblasts. Preliminary studies suggest that differential regulation of members of the jun family of early-response genes may explain this apparent paradox and determine whether stromelysin is induced or repressed by growth factors. TGF-beta stimulation therefore initiates a cascade of events that results in a specific pattern of gene expression: the direct stimulation of early-response genes can lead to subsequent induction or repression of other genes. Growth factor regulation of matrix metalloproteinases appears to play a role in embryonic development in the morphogenesis of the murine lung. Treatment of embryonic lungs in organ culture with the growth factors EGF or TGF-alpha results in stimulation of growth and inhibition of branching morphogenesis. A similar inhibition of branching was observed when these lung rudiments were treated with the matrix metalloproteinase collagenase. Most interestingly, the effects of EGF and TGF-alpha can be completely reversed by the tissue inhibitor of metalloproteinases, TIMP. TGF-beta has the opposite effect on growth of murine lung rudiments--growth is inhibited in a dose-dependent manner. This example illustrates a potential role for growth factor regulation of matrix-degrading metalloproteinases in complex developmental processes.
Mol
Reprod Dev 1992 Jun
PMID:Negative regulation of gene expression by TGF-beta. 163 49
The transcriptional mechanisms which contribute to the regulation of nerve growth factor (NGF) production are still largely unknown. We previously expressed the NGF promoter region in transgenic mice to localize cis regulatory elements to within 5 kb of the promoter. To further map these elements, and to begin to study the corresponding transacting factors, we here assayed the effects of 5' deletions and point mutations and examined the binding of nuclear factors to the NGF promoter region using L929 cell fibroblasts. Sequential deletions delineated regions upstream from the promoter which stimulated and inhibited transcription. DNAse-1 footprinting experiments identified four upstream segments, designated F2, F4, F6 and F8, which bound L929 cell nuclear proteins. F2 and F4 mapped to stimulatory and F6 and F8 to inhibitory regions. Competition experiments using a heptanucleotide present in both F2 and F4 segments suggested that they may be bound by related factors. Gel shift assays showed that the F8 binding proteins are less abundant in L929 cells than in NIH 3T3 fibroblasts and B16 melanoma cells. In addition to the upstream segments, a downstream
AP-1
consensus sequence bound L929 nuclear proteins. Mutation of the
AP-1
consensus sequence eliminated binding of nuclear proteins and reduced transcriptional activity. Our results indicate that transcriptional activator as well as suppressor regions surround the NGF gene promoter. The regulation of NGF production is likely to involve cis elements within these regions and transacting factors that bind to them.
Brain Res
Mol
Brain Res 1991 Oct
PMID:Structural and functional identification of regulatory regions and cis elements surrounding the nerve growth factor gene promoter. 166 23
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>