Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major secretory protein of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human
endometrial adenocarcinoma
cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59-bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis-elements.(ABSTRACT TRUNCATED AT 250 WORDS)
Mol
Endocrinol 1995 Oct
PMID:Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line. 854 48
During the secretory phase of the human menstrual cycle, the endometrium is minimally responsive to the estrogens secreted from the ovaries. Conjugation of beta-estradiol (E2) with sulfate is thought to be an important mechanism in the regulation of the levels of active E2 in endometrial tissue. Estrogen sulfation is reportedly increased during the secretory phase in response to the high levels of progesterone secreted by the ovaries. Estrogen sulfotransferase (hEST), a distinct form of human cytosolic sulfotransferase (ST) with an affinity for E2 and estrone at low nanomolar concentrations, has recently been cloned and expressed in mammalian cells and in bacteria (J Steroid Biochem
Mol
Biol 52:529, 1995). At least two other forms of human cytosolic ST, dehydroepiandrosterone ST (hDHEA-ST) and the phenol-sulfating form of phenol-ST (hP-PST), also conjugate estrogens but at micromolar concentrations. This report describes the specific induction of hEST in human Ishikawa
endometrial adenocarcinoma
cells by progesterone as a model for the increases in estrogen sulfation observed in women during the secretory phase of the menstrual cycle. Treatment of Ishikawa cells with 10 microns progesterone for 48 h resulted in a 7-fold increase in the sulfation of 20 nM E2. The sulfation of selective substrates for human dehydroepiandrosterone sulfotransferase (hDHEA-ST) and the two forms of phenol sulfotransferase (hP-PST, hM-PST) were not affected by treatment with progesterone. The levels of immunoreactive hEST and hEST mRNA in the Ishikawa cells were both increased by progesterone, whereas the levels of immunoreactive hDHEA-ST, hP-PST, and hM-PST were not altered. hEST activity was not induced by treatment of Ishikawa cells with varying concentrations of E2, testosterone, or cortisol. The induction of hEST by progesterone was inhibited by RU-486, indicating that progesterone is acting via the progesterone receptor. These results indicate that progesterone is capable of specifically inducing hEST and estrogen sulfation in human Ishikawa adenocarcinoma cells and suggest a mechanism for increasing estrogen sulfation in the endometrium during the secretory phase of the menstrual cycle.
...
PMID:Regulation of estrogen sulfotransferase in human endometrial adenocarcinoma cells by progesterone. 862 16
The recently established, estrogen receptor positive rat
endometrial adenocarcinoma
cell line RUCA-I was tested for estrogen responsiveness in vivo and in vitro. In vivo, 10(6) RUCA-I cells were injected subcutaneously into intact, ovariectomized, or ovariectomized, estradiol-substituted syngenic DA/Han rats. All animals developed well differentiated
endometrial adenocarcinoma
, that had metastasized to peripheral lymph nodes and into the lung. Ovariectomy reduced tumor and lymph node weight, as well as number of lung metastases significantly compared to controls. In another series of experiments, treatment with the pure anti-estrogen ZK 119010 basically gave the same results as seen in ovariectomized animals, whereas tamoxifen treatment had no effect on metastasis of RUCA-I cells. These findings clearly demonstrate the estrogen dependency of growth and metastasis of RUCA-I cells in vivo. In vitro, we assessed the estrogenic and anti-estrogenic potency of various anti-estrogens, thereby investigating their effects on the expression of components of the complement C3 complex as an estradiol-induced protein and on the expression of fibronectin as an estrogen-repressed protein. Evaluating the relative anti-estrogenic potency of these anti-estrogens we found that ICI 164384 and ICI 182780 behaved as complete antagonists in vitro. Tamoxifen, like estradiol, stimulated complement C3 production and repressed fibronectin expression and has to be regarded as an agonist in this particular in vitro system. ZK 119010 if given alone had no significant influence on the biosynthesis of complement C3 and of fibronectin if compared to the unstimulated control. In addition, another estrogen dependent parameter was identified. Estrogen and anti-estrogen treatment affected glycosylation of complement C3 components. After estradiol treatment predominantly the higher glycosylated epitope of complement C3 became detectable, which could be transformed into the low molecular weight epitope by treatment with hyaluronidase. Finally, we compared the anti-proliferative effects of ICI 164384 and of tamoxifen in vitro. Both anti-estrogens slightly inhibited the growth of RUCA-I rat
endometrial adenocarcinoma
cells. In conclusion, RUCA-I cells represent a powerful, endometrial derived experimental model to test the agonistic and antagonistic properties of anti-estrogens on growth and metastasis in vivo and on gene expression in vitro. The effects of the tested anti-estrogens on gene expression of RUCA-I cells were found to be useful in predicting their effectiveness on tumor growth in vivo.
J Steroid Biochem
Mol
Biol 1996 Apr
PMID:The rat endometrial adenocarcinoma cell line RUCA-I: a novel hormone-responsive in vivo/in vitro tumor model. 880 92
Endometrial progesterone receptors (PR) are regulated by both estrogen (E2) and progesterone (P) and mediate the expression of specific endometrial proteins. Ishikawa cells are a well-differentiated human
endometrial adenocarcinoma
cell line, with both estrogen receptors (ER) and PR, regulated in a manner similar to that of normal endometrium. Immunohistochemical and biochemical analyses demonstrate that the concentration of PR is increased by E2 priming and decreased by subsequent treatment with P. Scatchard plot analysis showed a K(d) of 1 nM. On the basis of biochemical analysis, PR concentrations reached approximately 1400 fmol/mg cytosol protein in cells after treatment with E2 (10(-8) M) for 4 days. Immunoprecipitation and Western blot studies revealed the presence of both the 116 kDa and 81 kDa proteins with multiple isoforms of the high molecular weight (MW) protein. Northern blot analysis demonstrated transcriptional control of PR by steroid treatment. These studies demonstrate the coordinate regulation of all PR mRNA species. The functionality of Ishikawa PR was demonstrated by the expression of alpha1beta1 integrin in response to E2 plus P, at the level of transcription and translation. This effect was blocked by the addition of the anti-progestin, RU-486. These studies reconfirm that the Ishikawa cell line is an excellent model for the study of hormonally regulated events in the human endometrial epithelium.
J Steroid Biochem
Mol
Biol 1996 Sep
PMID:Characterization of the functional progesterone receptor in an endometrial adenocarcinoma cell line (Ishikawa): progesterone-induced expression of the alpha1 integrin. 900 35
The present studies concern sulphotransferase activities for estrogens and other steroids, and 17beta-hydroxysteroid dehydrogenase (17beta-HSD) activities for estrogens in Ishikawa
endometrial adenocarcinoma
cells. When physiological concentrations of various estrogens (estrone, estradiol, estriol) are incubated, most of the transformation product is the respective sulphate. The sulphotransferase activity is very rapid, and 2 h after incubation 70-95% are converted to the sulphated form. Sulphates are found exclusively in the culture medium, which suggests that as soon as the sulphate is biosynthesized it is secreted to the medium. Comparative data using neutral steroids (dehydroepiandrosterone, testosterone, and pregnenolone) show that sulphotransferase activity for these compounds is very limited. In another series of studies, 17beta-HSD activity was explored for the interconversion estrone estradiol. At low concentrations (5 x 10(-9)-5 x 10(-8) M), when estradiol (E2) is incubated, most of the unconjugated material remains as E2 in the cellular compartment, but at high concentrations (5 x 10(-7)-5 x 10(-6) M) a great proportion (70-80%) of the E2 is converted to estrone (E1). On the other hand, after incubation of E1 at all concentrations most remained as unchanged E1. It is suggested that, in Ishikawa cells, at very low concentrations of E1 or E2, sulphotransferases are predominant, but when this enzyme is saturated 17beta-HSD activity is orientated to the oxidative form.
J Steroid Biochem
Mol
Biol 1997 Apr
PMID:Steroid sulphotransferase and 17beta-hydroxysteroid dehydrogenase activities in Ishikawa human endometrial adenocarcinoma cells. 932 7
Leukaemia inhibitory factor (LIF) is a pleiotropic cytokine which has been found to be expressed in the human endometrium and to play an important role in human reproduction. In the present study we investigated expression and regulation of the human LIF promoter in HEC-1B
endometrial adenocarcinoma
cells using a luciferase reporter plasmid bearing a 666 bp promoter fragment (h666LIF-Luc) in transient transfection assays. HEC-1B cells were first shown by reverse transcription-polymerase chain reaction (RT-PCR) to be able to produce endogenous LIF mRNA. The LIF promoter was efficiently transcribed in HEC-1B cells, showing much higher levels of basal activity than in the previously studied Jurkat T-lymphoma cells and SKUT-1B uterine mesodermal tumour cells. The activity of the LIF promoter was stimulated in HEC-1B cells by a combination of phorbol ester (TPA) and ionomycin, which we had previously found to strongly induce its activity in Jurkat T-lymphoma cells. We next studied the effect of progestin (medroxyprogesterone acetate; MPA) on the LIF promoter activity in HEC-1B cells. The LIF promoter was not stimulated by MPA treatment in the presence of transfected progesterone receptor B (PR-B) expression vector in HEC-1B cells, while we had previously described its induction by MPA in SKUT-1B cells. This indicates that progestin-dependent regulation of the LIF promoter in uterine tumour cells is different in cells of epithelial and mesodermal origin.
Mol
Hum Reprod 1997 Sep
PMID:Regulation of the human leukaemia inhibitory factor (LIF) promoter in HEC-1B endometrial adenocarcinoma cells. 935 5
Estrogens are believed to play a crucial role in growth regulation and differentiation of the normal endometrial tissue as well as in the carcinogenesis of the endometrium. Therefore, the influence of estrogens and antiestrogens on gene expression in the estrogen receptor-positive rat
endometrial adenocarcinoma
cell line RUCA-I was investigated. Differentially expressed genes were detected by differential display PCR of RNA of untreated, estradiol-treated and antiestrogen-treated RUCA-I cells. By means of the PCR technique, 14 differentially expressed fragments could be detected. Three of these 14 differentially expressed fragments were confirmed by Northern blotting. The steady state mRNA levels of the three gene fragments named AH41, AH42 and AH44 were downregulated by the antiestrogen ICI 164384. Further characterization revealed that the fragment AH41 is not expressed in stromal cells but in the human and rodent epithelial cell lines, BG-1 and RUCA-II. A comparison of the cDNA sequence of fragment AH41 with the EMBL database showed no high homology to known genes. Therefore, fragment AH41 has to be regarded as a fragment of a novel, estradiol-sensitive gene.
J Steroid Biochem
Mol
Biol 1997 Aug
PMID:Estrogen-dependent and cell-specific regulation of gene expression in RUCA-I endometrial adenocarcinoma cells. 944 46
To elucidate potential mechanisms involved in the increased incidence of endometrial carcinomas in tamoxifen-treated patients, we examined the in-vitro effects of tamoxifen on endometrial cancer cells. The effects of tamoxifen, alone and in combination with oestradiol, on cell proliferation, plasminogen activator (PA) activity, glycogen synthase and phosphorylase activities, p53 protein concentration, and collagenase expression were assessed in two human adenocarcinoma cell lines. These lines were the oestrogen receptor-positive (Ishikawa) cells, representing a well-differentiated
endometrial adenocarcinoma
, and oestrogen receptor-negative (HEC-1A) cells, derived from a poorly differentiated
endometrial adenocarcinoma
. Tamoxifen or oestradiol alone and their combination significantly enhanced cellular proliferation of Ishikawa but not of HEC-1A cells. Both lines produced appreciable PA activity, most of which was of the urokinase type. Tamoxifen and oestradiol stimulated this activity in Ishikawa cells but not in HEC-1A cells. The effect of oestradiol was dose-dependent in a linear fashion, while tamoxifen produced a stimulation peaking at 10(-8) M and declining at higher concentrations. Tamoxifen in combination with oestradiol exhibited a synergistic effect on proliferation and on PA activity. The response of PA extended beyond the increase in proliferation, leading to higher specific activity of PA in the tamoxifen-treated cultures. In Ishikawa cells, oestradiol also increased glycogen synthase and glycogen phosphorylase activities, while tamoxifen markedly suppressed these enzymes. Oestradiol, tamoxifen, and their combination had no apparent effect on the expression of protein p53 in Ishikawa cells, or on gelatinase activity in either Ishikawa or HEC-1A cells. The present findings imply that tamoxifen produces oestrogen-agonistic effects on cell proliferation and PA activity, and oestrogen antagonistic effects on glycogen synthase and glycogen phosphorylase activities, but fails to regulate p53 and gelatinase expression. The tamoxifen-responsive systems were only observed in oestrogen-responsive adenocarcinoma cells. Thus, only certain potential oncogenic effects of tamoxifen can be simulated in vitro, and when present, these effects are enhanced in the presence of oestradiol.
Mol
Hum Reprod 1997 Dec
PMID:Tamoxifen exerts oestrogen-agonistic effects on proliferation and plasminogen activation, but not on gelatinase activity, glycogen metabolism and p53 protein expression, in cultures of oestrogen-responsive human endometrial adenocarcinoma cells. 946 46
Sulfation is an important conjugation reaction in the metabolism of steroids. Steroids sulfates do not interact with the appropriate hormone receptors; additionally, the presence of the charged sulfate moiety increases the aqueous solubility and excretion of most steroids. Estrogen sulfotransferase (EST) is the major form of human cytosolic ST involved in the conjugation of estrogens. EST is important in the inactivation of beta-estradiol (E2) during the luteal phase of the menstrual cycle. EST has a significantly higher affinity for the sulfation of E2 and 17alpha-ethinylestradiol (EE2) than for other potent estrogens such as diethylstilbestrol (DES) and equine estrogens. The ability of EST to sulfate these estrogenic compounds at physiologic concentrations is important in regulating their activation of the ER in estrogen responsive cells. Human Ishikawa
endometrial adenocarcinoma
(ISH) cells possess an estrogen receptor (ER)-regulated alkaline phosphatase (AlkPhos) which is used to assay ER activation. To study the effects of EST activity on the ER activation of different estrogenic compounds, ISH cells were stably transformed with an EST expression vector. Dose-response curves for the induction of AlkPhos activity by the different estrogenic compounds were generated with EST/ISH and control pcDNA/ISH cells. EST/ISH cells were 200-fold less sensitive to E2 and EE2 than were control cells. No differences were observed in the dose response curves for DES between EST/ISH and pcDNA/ISH cells. EST/ISH cells were approximately 3-10-fold less sensitive to the equine estrogens equilin and 17-equilin as compared to control cells. The ability of EST to decrease the ER activation of an estrogen correlates with the sulfation of these compounds at nanomolar concentrations by EST/ISH and pcDNA/ISH ISH cells. These results indicate that EST is capable of efficiently inactivating E2 and EE2 but is significantly less effective in inhibiting the ER binding of other potent estrogenic compounds.
J Steroid Biochem
Mol
Biol 1999 Feb
PMID:Regulation of estrogen activity by sulfation in human Ishikawa endometrial adenocarcinoma cells. 1036 11
Loss of DNA mismatch repair (MMR) causes genomic instability by markedly increasing the frequency of sporadic mutations in both coding and noncoding sequences. Little is known about how loss of MMR affects sensitivity to the mutagenic effect of chemotherapeutic agents. We wanted to determine how loss of MMR affects the ability of cisplatin, a known mutagen, to generate human tumor cell variants resistant to other drugs with which cisplatin is commonly combined in treatment regimens. We compared the ability of cisplatin to produce variants resistant to topotecan, gemcitabine, and paclitaxel in two pairs of MMR-proficient and -deficient cells that included sublines of the human colon carcinoma cell line HCT-116 and sublines of the human
endometrial adenocarcinoma
cell line HEC59. Cells were exposed to increasing concentrations of cisplatin for 1 h, and the surviving population was tested for the frequency of variants resistant to these single molecular target drugs 10 days later. The frequency of variants increased linearly with cisplatin concentration for all three drugs. Cisplatin was 2.6 +/- 0.3- (S.D.), 3.6 +/- 0.9-, and 2.3 +/- 0.1-fold more potent at producing topotecan-, gemcitabine-, and paclitaxel-resistant variants in the MMR-deficient than in the MMR-proficient HCT116 cells (P <.05 for all). Cisplatin was 1.4 +/- 0.3- and 1.4 +/- 0.4-fold more potent at generating topotecan- and gemcitabine-resistant variants in MMR-deficient HEC59 cells than in MMR-proficient HEC59+ch2 cells. Cisplatin was not more potent in generating paclitaxel-resistant variants in the MMR-deficient HEC59 cells. Spontaneous rates of generation of cells resistant to these three drugs were also measured in the HCT116 sublines. MMR-deficient HCT116 cells exhibited rates of generation of resistant variants that were 1.94- and 1.51-fold higher (P <.05) than those in the MMR-proficient cells for topotecan and gemcitabine, respectively; loss of MMR had no effect on the rate of generation of variants resistant to paclitaxel. We conclude that the loss of MMR increases the ability of cisplatin to generate variants resistant to topotecan, gemcitabine, and possibly paclitaxel and that MMR also plays a role in controlling the spontaneous rate of generation of variants resistant to topotecan and gemcitabine.
Mol
Pharmacol 1999 Aug
PMID:Effect of loss of DNA mismatch repair on development of topotecan-, gemcitabine-, and paclitaxel-resistant variants after exposure to cisplatin. 1041 59
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>