Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The enhanced expression of the RI alpha subunit of cyclic AMP-dependent protein kinase type 1 (PKA-1) has been correlated with cancer cell growth. We have investigated the effects of sequence-specific inhibition of RI alpha gene expression on the growth of MCF-7 human breast cancer cells. We report that RI alpha antisense treatment results in a reduction in RI alpha expression at both mRNA and protein levels and inhibition of cell growth. The growth inhibition was accompanied by changes in cell morphology, cleavage of poly(ADP-ribose) polymerase (PARP) and appearance of apoptotic nuclei. In addition, bcl-2 protein level was reduced and p53 expression increased in growth arrested cells. Interestingly, RI alpha antisense inhibited cell viability and induced apoptosis in the absence of p53, suggesting that these actions of RI alpha antisense are exerted independent of p53. In contrast, two- and four-base mismatched control oligonucleotides had no effect on either cell growth or morphology. These results demonstrate that the RI alpha antisense, which efficiently depletes the growth stimulatory molecule RI alpha, induces cell differentiation and apoptosis, providing a new approach to combat breast cancer cell growth.
Mol Cell Biochem 1999 May
PMID:Growth arrest and induction of apoptosis in breast cancer cells by antisense depletion of protein kinase A-RI alpha subunit: p53-independent mechanism of action. 1039 66

Myocardial ischemia and reperfusion lead to myocyte cell death, at least in part, by an apoptotic mechanism. Caspases are a conserved family of proteases that play an essential role in the execution of apoptosis; however, their potential contribution to ischemic myocardial cell death is largely unknown. To examine their role in this process, we subjected rabbits to 30 min of coronary artery occlusion followed by 3 h of reperfusion. Immunoblot analyses revealed that caspases-2, -3 and -7 were proteolytically activated during myocardial ischemia and reperfusion in vivo. In addition, the well-characterized caspase substrate poly(ADP-ribose) polymerase (PARP) was selectively cleaved into its signature apoptotic fragment in ischemic/reperfused myocardium. Systemic administration of the broad-spectrum caspase inhibitor acetyl-Tyr-Val-Ala-Asp chloromethylketone (YVAD-cmk, 4.8 mg/kg) partially blocked caspase activation and dramatically reduced the percentage of terminal dUTP deoyxynucleotidyl-transferase nick end-labeling (TUNEL)-positive myocyte nuclei in the infarct region (3.9+/-0.8%v 13.0+/-2.2% in control animals, P=0.012). Moreover, YVAD-cmk reduced myocardial infarct size by approximately 31% (31.1+/-3.3%v 45.3+/-4.9% in control animals, P=0.032). These results indicate that caspases are critical mediators of myocardial injury induced by ischemia and reperfusion in vivo, and they suggest that caspase inhibition may be therapeutically beneficial in myocardial infarction.
J Mol Cell Cardiol 1999 Sep
PMID:Caspase inhibition reduces myocyte cell death induced by myocardial ischemia and reperfusion in vivo. 1047 54

Some widely used antidepressants such as imipramine, clomipramine, and citalopram have been found to possess antineoplastic effects. In the present study, these compounds were found to induce apoptotic cell death in human acute myeloid leukemia HL-60 cells. Apoptosis induced by the antidepressants was identified by electron microscopy and conventional agarose gel electrophoresis and was quantitated by propodium iodide staining and the terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) via flow cytometry. Treatment with apoptosis-inducing concentrations of the antidepressants (80 microM imipramine, 35 microM clomipramine, or 220 microM citalopram) caused induction of caspase-3/caspase-3-like activity, which was monitored by the cleavage of poly(ADP-ribose) polymerase (PARP), the loss of the 32 kD caspase-3 (CPP32) precursor, and the cleavage of the fluorescent CPP32-like substrate PhiPhiLux. Pretreatment with a potent caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl-ketone (zVAD-fmk) inhibited antidepressant-induced CPP32/CPP32-like activity and apoptosis. Furthermore, activation of caspase induced by the antidepressants was preceded by the hypergeneration of intracellular reactive oxygen species (ROS). These results suggested that the antidepressants may induce apoptosis via a caspase-3-dependent pathway, and induction of apoptosis by the antidepressants may provide a clue for the mechanism of their antineoplastic effects.
J Biochem Mol Toxicol 1999
PMID:The antidepressants imipramine, clomipramine, and citalopram induce apoptosis in human acute myeloid leukemia HL-60 cells via caspase-3 activation. 1048 22

Poly(ADP-ribosylation) is a post-translational modification playing a relevant role in DNA damage recovery, DNA replication and viral integration. Several reports also suggest a modulation of this process during cell death by apoptosis. The aim of this review is to discuss the possible involvement of poly(ADP-ribosylation) during apoptosis, by dealing with general considerations on apoptosis, and further examining the correlation between NAD consumption and cell death, the regulation of poly(ADP-ribose) metabolism in apoptotic cells, the effect of poly(ADP-ribose) polymerase inhibition on cell death occurrence and the use of enzyme cleavage as a marker of apoptosis. Finally, the future prospects of the research in this area will be addressed.
Mol Cell Biochem 1999 Sep
PMID:Poly(ADP-ribosylation) and apoptosis. 1054 61

Granule-mediated cell killing by cytotoxic lymphocytes requires the combined actions of a membranolytic protein, perforin, and granule-associated granzymes, but the mechanism by which they jointly kill cells is poorly understood. We have tested a series of membrane-disruptive agents including bacterial pore-forming toxins and hemolytic complement for their ability to replace perforin in facilitating granzyme B-mediated cell death. As with perforin, low concentrations of streptolysin O and pneumolysin (causing <10% (51)Cr release) permitted granzyme B-dependent apoptosis of Jurkat and Yac-1 cells, but staphylococcal alpha-toxin and complement were ineffective, regardless of concentration. The ensuing nuclear apoptotic damage was caspase dependent and included cleavage of poly(ADP-ribose) polymerase, suggesting a mode of action similar to that of perforin. The plasma membrane lesions formed at low dose by perforin, pneumolysin, and streptolysin did not permit diffusion of fluorescein-labeled proteins as small as 8 kDa into the cell, indicating that large membrane defects are not necessary for granzymes (32 to 65 kDa) to enter the cytosol and induce apoptosis. The endosomolytic toxin, listeriolysin O, also effected granzyme B-mediated cell death at concentrations which produced no appreciable cell membrane damage. Cells pretreated with inhibitors of endosomal trafficking such as brefeldin A took up granzyme B normally but demonstrated seriously impaired nuclear targeting of granzyme B when perforin was also added, indicating that an important role of perforin is to disrupt vesicular protein trafficking. Surprisingly, cells exposed to granzyme B with perforin concentrations that produced nearly maximal (51)Cr release (1,600 U/ml) also underwent apoptosis despite excluding a 8-kDa fluorescein-labeled protein marker. Only at concentrations of >4,000 U/ml were perforin pores demonstrably large enough to account for transmembrane diffusion of granzyme B. We conclude that pore formation may allow granzyme B direct cytosolic access only when perforin is delivered at very high concentrations, while perforin's ability to disrupt endosomal trafficking may be crucial when it is present at lower concentrations or in killing cells that efficiently repair perforin pores.
Mol Cell Biol 1999 Dec
PMID:Cytosolic delivery of granzyme B by bacterial toxins: evidence that endosomal disruption, in addition to transmembrane pore formation, is an important function of perforin. 1056 84

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.
Hum Mol Genet 2000 Jan 22
PMID:Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase. 1060 29

Tanshinone II-A is a derivative of phenanthrene-quinone isolated from Salvia miltiorrhiza BUNGE, a traditional herbal medicine that is known to induce antiinflammatory, anti-oxidative and cytotoxic activity. We have examined cellular effects of Tanshione II-A on HL60 human promyelocytic leukemic cells and K562 human erythroleukemic cells. Tanshione II-A induced a dose- and time-dependent DNA fragmentation into the multiples of 180 bp and specific proteolytic cleavage of poly(ADP-ribose) polymerase in both cell lines. PI-staining and flow cytometry analysis of K562 cells following Tanshione II-A treatment showed an increase of the cells possessing hypodiploid DNA indicative of apoptotic state of cells. Caspase-3 activity was significantly increased during Tanshinone II-A treatment of both HL60 and K562 cells, whereas caspase-1 activity was not changed. These results suggest that Tanshione II-A induced HL60 and K562 cellular apoptosis that may be associated with the selective members of caspase family.
Exp Mol Med 1999 Dec 31
PMID:Tanshinone IIA, an ingredient of Salvia miltiorrhiza BUNGE, induces apoptosis in human leukemia cell lines through the activation of caspase-3. 1063 Mar 70

Both cAMP and retinoids play a role in cell differentiation and the control of cell growth. A site-selective cAMP analog, 8-Cl-cAMP and retinoic acid synergistically inhibit growth and induce apoptosis in certain cancer cells. In advanced or recurrent malignant diseases, retinoic acid (RA) is not effective even at doses that are toxic to the host. The objective of our present study was to examine the mechanism(s) of synergistic effects of retinoic acid (9-cis, 13-cis or all-trans RA) and 8-Cl-cAMP on apoptosis in human ovarian cancer NIH: OVCAR-3 and OVCAR-8 cells. RA induced growth inhibition and apoptosis in OVCAR-3 and OVCAR-8 cells. 8-Cl-cAMP acted synergistically with RA in inducing and activating retinoic acid receptor beta (RARbeta) which correlates with growth inhibition and apoptosis in both cell types. In addition, induction of apoptosis by RA plus 8-Cl-cAMP requires caspase-3 activation followed by cleavage of anti-poly(ADP-ribose) polymerase. Furthermore, mutations in CRE-related motif within the RARbeta promoter resulted in loss of both transcriptional activation of RARbeta and synergy between RA and 8-Cl-cAMP. RARbeta expression appears to be associated with induction of apoptosis. Introduction of the RARbeta gene into OVCAR-3 cells resulted in gain of RA sensitivity. Loss of RARbeta expression, therefore, may contribute to the tumorigenicity of human ovarian cancer cells. Thus, combined treatment with RA and 8-Cl-cAMP may provide an effective means for inducing RARbeta expression leading to apoptosis in ovarian cancer cells.
Mol Cell Biochem 2000 Jan
PMID:Synergistic effects of 8-Cl-cAMP and retinoic acids in the inhibition of growth and induction of apoptosis in ovarian cancer cells: induction of retinoic acid receptor beta. 1071 18

Ligand-activated progesterone receptors (PR) bind to DNA at specific progesterone response elements by means of a DNA binding domain (DBD(PR)) containing two highly conserved zinc fingers. DNA-bound PRs regulate transcription via interaction with other nuclear proteins and transcription factors. We have now identified four HeLa cell nuclear proteins that copurify with a glutathionine-S-transferase-human DBD(PR )fusion protein. Microsequence and immunoblot analyses identified one of these proteins as the 113 kDa poly(ADP-ribose) polymerase. The three other proteins were identified as subunits of the DNA-dependent protein kinase (DNA-PK) holoenzyme: its DNA binding regulatory heterodimers consisting of Ku70 and Ku86, and the 460 kDa catalytic subunit, DNA-PK(CS). DNA-PK that was 'pulled-down' by DBD(PR) on the affinity resin was able to (1) autophosphorylate Ku70, Ku86, and DNA-PK(CS), (2) transphosphorylate DBD(PR), and (3) phosphorylate a DNA-PK-specific p53 peptide substrate. DNA-PK was also able to associate with the DBD of the yeast activator GAL4. However, neither a PR DBD mutant lacking a structured first zinc finger (DBD(CYS)) nor the core DBD of the estrogen receptor (DBD(ER)) copurified DNA-PK, suggesting the interaction is not non-specific for DBDs. Lastly, we found that DNA-PK copurified with full-length human PR transiently expressed in HeLa cells, suggesting that the human PR/DNA-PK complex can assemble in vivo. These data show that DNA-PK and DBD(PR) interact, that DBD(PR) is a phosphorylation substrate of DNA-PK, and suggest a potential role for DNA-PK in PR-mediated transcription.
J Mol Endocrinol 2000 Apr
PMID:Association of the Ku autoantigen/DNA-dependent protein kinase holoenzyme and poly(ADP-ribose) polymerase with the DNA binding domain of progesterone receptors. 1075 18

HEF1 (human enhancer of filamentation 1) is a member of a docking protein family that includes p130(Cas) and Efs. Through assembly of multiple protein interactions at focal adhesion sites, these proteins activate signaling cascades in response to integrin receptor binding of the extracellular matrix. The HEF1 protein is cell cycle regulated, with full-length forms cleaved in mitosis at a caspase consensus site to generate an amino-terminal 55-kDa form that localizes to the mitotic spindle. The identification of a caspase cleavage site in HEF1 led us to investigate whether HEF1 belongs to a select group of caspase substrates cleaved in apoptosis to promote the morphological changes characteristic of programmed cell death. Significantly, inducing expression of HEF1 in MCF-7 or HeLa cells causes extensive apoptosis, as assessed by multiple criteria. Endogenous HEF1 is cleaved into 65- and 55-kDa fragments and a newly detected 28-kDa form in response to the induction of apoptosis, paralleling cleavage of poly(ADP-ribose) polymerase and focal adhesion kinase (FAK); the death-promoting activity of over-expressed HEF1 is associated with production of the 28-kDa form. While the generation of the cleaved HEF1 forms is caspase dependent, the accumulation of HEF1 forms is further regulated by the proteasome, as the proteasome inhibitors N-acetyl-L-leucinyl-L-leucinyl-L-norleucinyl and lactacystin enhance their stability. Finally, the induction of HEF1 expression also increases Jun N-terminal protein kinase (JNK) activation, and activated JNK colocalizes with HEF1, implicating this pathway in HEF1 action. Based on these results, we propose that dysregulation of HEF1 and its family members along with FAK may signal the destruction of focal adhesion sites and regulate the onset of apoptosis.
Mol Cell Biol 2000 Jul
PMID:The docking protein HEF1 is an apoptotic mediator at focal adhesion sites. 1086 74


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>