Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The structure of the Escherichia coli thymidylate synthase (TS) covalent inhibitory ternary complex consisting of enzyme, 5-fluoro-2'-deoxyuridylate (FdUMP) and 5,10-methylene tetrahydrofolate (CH2-H4PteGlu) has been determined at 2.5 A resolution using difference Fourier methods. This complex is believed to be a stable structural analog of a true catalytic intermediate. Knowledge of its three-dimensional structure and that for the apo enzyme, also reported here, suggests for the first time how TS may activate dUMP and CH2-H4PteGlu leading to formation of the intermediate and offers additional support for the hypothesis that the substrate and cofactor are linked by a methylene bridge between C-5 of the substrate nucleotide and N-5 of the cofactor. By correlating these structural results with the known stereospecificity of the TS-catalyzed reaction it can be inferred that the catalytic intermediate, once formed, must undergo a conformational isomerization before eliminating across the bond linking C-5 of dUMP to C-11 of the cofactor. The elimination itself may be catalyzed by proton transfer to the cofactor's 5 nitrogen from invariant Asp169 buried deep in the TS active site. The juxtaposition of Asp169 and bound tetrahydrofolate in TS is remarkably reminiscent of binding geometry found in dihydrofolate reductase where a similarly conserved carboxyl group serves as a general acid for protonating the corresponding pyrazine ring nitrogen of dihydrofolate.
J Mol Biol 1990 Aug 20
PMID:Stereochemical mechanism of action for thymidylate synthase based on the X-ray structure of the covalent inhibitory ternary complex with 5-fluoro-2'-deoxyuridylate and 5,10-methylenetetrahydrofolate. 220 79

The mouse dihydrofolate reductase (Dhfr) promoter region is buried within a CpG island (a region rich in unmethylated CpG dinucleotides), has a high G+C content, and lacks CAAT and TATA elements. The region contains four 48-bp repeats, each of which contains an Sp1-binding site. Another gene, Rep-3 (formerly designated Rep-1), shares the same general promoter region with Dhfr, being transcribed in the direction opposite that of Dhfr. Both genes appear to be housekeeping genes and are expressed at relatively low levels in all tissues. The 5' termini of the major Dhfr transcripts are separated from the 5' termini of the Rep-3 transcripts by approximately 140 bp. This curious structural arrangement suggested that the two genes might share common regulatory elements. To investigate the promoter sequences driving bidirectional transcription, a series of promoter mutations was constructed. These mutations were assayed by a replicating minigene system and by promoter fusions to the chloramphenicol acetyltransferase gene. Linker-scanning mutations that spanned the four repeats produced a variety of mRNA transcript phenotypes. The effects were primarily quantitative, generally reducing the abundance of transcripts for one or both genes. Some mutations affected Dhfr in a qualitative manner, such as by changing the startpoint of one of the major Dhfr transcripts or changing the relative abundance of the two major Dhfr transcripts. Additionally, protein transcription factors that bind to sequences in the mouse Dhfr/Rep-3 major promoter region, potentially affecting expression of either or both genes, were investigated by DNase I footprinting. The results indicate that multiple protein-DNA interactions occur in this region, reflecting potentially complex transcriptional control mechanisms that might modulate expression of either or both genes under different physiological conditions.
Mol Cell Biol 1990 Nov
PMID:Analysis of the mouse Dhfr/Rep-3 major promoter region by using linker-scanning and internal deletion mutations and DNase I footprinting. 223 29

Selection of the rodent malaria Plasmodium chabaudi with low levels of the antifolate drug pyrimethamine has previously been shown by us to result in duplication of the dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene by a duplication of chromosome 7 and subsequent rearrangements. We have selected this resultant parasite line with large doses of pyrimethamine and analysed the DHFR-TS gene and chromosomes for any changes. Increased drug pressure has resulted in reappearance of a chromosome with the same structure as chromosome 7 from DS the parent line. Sequencing of the DHFR gene from each of the chromosomes has identified a single point mutation that results in a serine to asparagine change at position 106. This is the equivalent mutation that has been identified as the key residue in the mechanism of resistance to pyrimethamine in Plasmodium falciparum. There is no apparent increase in transcription of the DHFR-TS gene and the large increase in resistance is most likely a result of the mutation in the DHFR gene.
Mol Biochem Parasitol 1990 Aug
PMID:Chromosomal rearrangements and point mutations in the DHFR-TS gene of Plasmodium chabaudi under antifolate selection. 223 98

We have identified dihydrofolate reductase (DHFR) gene point mutations and chromosomal changes in pyrimethamine-resistant mutants selected in vitro of Plasmodium falciparum strain FCR3. A pyrimethamine-resistant derivative of the pyrimethamine-sensitive strain FCR3, FCR3-D8, that had been grown in the absence of pyrimethamine for an extended time, was grown in two concentrations of pyrimethamine, and surviving drug-resistant parasites were subcloned. One selected mutant, FCR3-D81, that grew at 1 X 10(-6) M pyrimethamine, contained a single point mutation in the DHFR domain which caused an amino acid change (Phe to Ser) at amino acid 223, whereas another mutant, FCR3-D85, that grew at 5 X 10(-6) M pyrimethamine had that same mutation and an additional point mutation that changed amino acid 54 (Asp to Asn). The selection of FCR3-D85, whose nucleotide sequence was identical to that previously reported for FCR3-D8, confirmed that the original FCR3-D8 parasite population had changed during extended growth in vitro in the absence of drug pressure. FCR3-D81 and FCR3-D85 cells contained different pairs of polymorphic chromosomes that hybridized to a DHFR-TS probe as well as to three other chromosome 4 specific DNAs, indicating that at least part of chromosome 4 had been duplicated and that these parasites were aneuploid with 15 rather than 14 chromosomes. The mutant DHFR-TS genes were diploid. We consider the roles of the polymorphic chromosome duplications and DHFR point mutation(s) as causes of pyrimethamine resistance.
Mol Biochem Parasitol 1990 Aug
PMID:Mutant dihydrofolate reductase-thymidylate synthase genes in pyrimethamine-resistant Plasmodium falciparum with polymorphic chromosome duplications. 223 1

Numerous genes contain TATAA-less promoters, and the control of transcriptional initiation in this important promoter class is not understood. We have determined that protein-DNA interactions at three of the four proximal GC box sequence elements in one such promoter, that of the hamster dihydrofolate reductase gene, control initiation and relative use of the major and minor start sites. Our results indicate that although the GC boxes are apparently equivalent with respect to factor binding, they are not equivalent with respect to function. At least two properly positioned GC boxes were required for initiation of transcription. Abolishment of DNA-protein interaction by site-specific mutation of the most proximal GC box (box I) resulted in a fivefold decrease in transcription from the major initiation site and a threefold increase in heterogeneous transcripts initiating from the vicinity of the minor start site in vitro and in vivo. Mutations that separately abolished interactions at GC boxes II and III while leaving GC box I intact affected the relative utilization of both the major and minor initiation sites as well as transcriptional efficiency of the promoter template in in vitro transcription and transient expression assays. Interaction at GC box IV when the three proximal boxes were in a wild-type configuration had no effect on transcription of the dihydrofolate reductase gene promoter. Thus, GC box interactions not only are required for efficient transcription but also regulate start site utilization in this TATAA-less promoter.
Mol Cell Biol 1990 Dec
PMID:Transcriptional initiation is controlled by upstream GC-box interactions in a TATAA-less promoter. 224 77

The pattern of mutations produced by a mutator gene (obtained during serial selection for amplification of the dihydrofolate reductase [dhfr] locus) shows a pronounced shift from that found in wild-type cells. The rate of certain types of base substitutions (particularly transitions) is dramatically increased, while gene rearrangements constitute a lower proportion of mutations. These data suggest a lower fidelity of the replication process in the mutator strain.
Mol Cell Biol 1990 Dec
PMID:Increased rate of base substitution in a hamster mutator strain obtained during serial selection for gene amplification. 224 84

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.
 ...
PMID:Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures. 225 31

This paper considers some of the landscape problems encountered in matching molecules by simulated annealing. Although the method is in theory ergodic, the global minimum in the objective function is not always encountered. Factors inherent in the molecular data that lead the trajectory of the minimization away from its optimal route are analysed. Segments comprised of the C alpha atoms of dihydrofolate reductase are used as test data. The evolution of a reverse ordering landscape problem is examined in detail. Where such patterns in the data could lead to incorrect matches, the problem can in part be circumvented by assigning an initial random ordering to the molecules.
J Comput Aided Mol Des 1990 Sep
PMID:Molecular structure matching by simulated annealing. II. An exploration of the evolution of configuration landscape problems. 228 Feb 67

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
J Mol Biol 1990 Jan 05
PMID:Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. 229 70

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Mol Cell Biol 1990 Feb
PMID:Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site. 230 58


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>