Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.
 ...
PMID:Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid. 109 86

An alkaline unwinding assay was used to quantitate the induction of DNA strand breaks (DNA SB) in the livers of rats and mice treated in vivo, in rodent hepatocytes in primary culture, and in CCRF-CEM cells, a human lymphoblastic leukemia cell line, following treatment with tri- (TCA), di- (DCA), and mono- (MCA) chloroacetic acid and their corresponding aldehydes, tri- (chloral hydrate, CH), di- (DCAA) and mono- (CAA) chloroacetaldehyde. None of the chloroacetic acids induced DNA SB in the livers of rats at 4 hr following a single administration of 1-10 mmole/kg. TCA (10 mmole/kg) and DCA (5 and 10 mmole/kg) did produce a small amount of strand breakage in mice (7% at 4 hr) but not at 1 hr. N-nitrosodiethylamine (DENA), an established alkylating agent and a rodent hepatocarcinogen, produced DNA SB in the livers of both species. TCA, DCA, and MCA also failed to induce DNA strand breaks in splenocytes and epithelial cells derived from the stomach and duodenum of mice treated in vivo. None of the three chloroacetaldehydes induced DNA SB in either mouse or rat liver. The continuous exposure of mice to 5 g/L DCA in the drinking water for 7 and 14 days did not induce appreciable hepatic DNA SB (< 10% at 14 days), although peroxisome proliferation, as evidenced by an increased cyanide-insensitive palmitoyl CoA oxidase (PCO) activity, was stimulated to 490% (7 days) and 652% (14 days) of control. Under this protocol, DENA (0.1 g/L) produced DNA damage after both 7 days (73% of control) and 14 days (57% of control). Similarly, long-term exposure of rats (30 weeks) to 2 g/L DCA in the drinking water, a level that increased PCO activity to 364% of the control value, exhibited no DNA damage. Both the chloroacetic acids and the chloroacetaldehydes were ineffective in inducing DNA SB in cultured rat and mouse hepatocytes at concentrations below those that yielded cytotoxicity. The chloroacetic acids were also ineffective in the CCRF-CEM cells. However, two of the chloroaldehydes, DCAA and CAA, did induce DNA SB in the CCRF-CEM cells at concentrations that did not decrease the cell viability after 2 hr of treatment. Prior incubation of DCAA and CAA with a rat S9 liver homogenate eliminated much of the DNA damaging activity. These studies provide further evidence that the chloroacetic acids lack genotoxic activity not only in rodent liver, a tissue in that they induce tumors, but in a variety of other roden tissues and cultured cell types.(ABSTRACT TRUNCATED AT 400 WORDS)
Environ Mol Mutagen 1992
PMID:Analysis of DNA strand breaks induced in rodent liver in vivo, hepatocytes in primary culture, and a human cell line by chlorinated acetic acids and chlorinated acetaldehydes. 133 May 47

About 1800 sequences of gene promoters, enhancers and other types of regulatory elements (REG) have been statistically analysed for investigation of a role for enzymatic DNA methylation in prokaryotes, yeasts, plants, invertebrates, animal viruses, vertebrates and human. The frequencies and localizations of CG and CNG methylated sites and also the number of CG-->TG+CA transitions in different series of REGs have been studied. It was showed that the pro- and eukaryotic REGs with the exception of yeast and drosophila ones have higher CpG-suppression values than the main genome in the same species. About 40% of all the point substitutions in pro- and eukaryotic REGs were found in the CG and CNG methylated sites, that are "hot spots" for C-->T transitions. More than 30% of all analysed REGs have neither sites CG nor CNG and so they are not capable of methylation in vivo. The methylated sites have not been localized in any specific regions of promoters and other types of REGs nor in the flanking sequences of the same genes. Only part of the homological REG's sequences have CG and CNG methylated sites. Therefore the methylation of cytosine residues in any REGs may be not an obligatory condition for normal regulation of the REG activity in cells. Two main REG's families of different length were unexpectedly found in the study. The length of the first one is 9-12 n. and the second is 17-20 n. The families are about 60-80% of other REGs. The essential deficiency of cytosine residues and also triplets of CGG, CCG, CTG and CAG has been showed in the "sense" chain of the REGs. The chain has some abundance of TTG, CCA and CAA triplets. The REG's chains have a strong asymmetry in purine and pyrimidine contents and also in duplets TG and CA frequencies. It may be the result of different reparation effectivity of G-T pairs produced by 5-meC residues deamination in DNA complementary chains. Therefore cytosine methylation in REGs may strongly destabilize the structure, accelerate its divergence in evolution, and disturb the REGs binding with protein factors regulating activity of the genes. The results showed that a function of DNA enzymatic methylation may be hardly realized through the modification of gene regulatory elements.
Mol Biol (Mosk)
PMID:[Enzymatic methylation of regulatory elements in controlling the activity of genes from various groups of organisms]. 133 47

Exon 1 polymorphism of the androgen receptor (AR) gene is characterized by a (CAG)n(CAA) repeat at position 172 following the translation start codon. The aim of this study was to determine whether AR gene exon 1 polymorphism could be used to perform prenatal diagnosis in high risk families with complete or partial androgen insensitivity syndrome. After enzymatic amplification of a 1 kilobase exon 1 fragment, each DNA was simultaneously digested by MspI and PstI restriction enzymes. After electrophoresis on a 15% electrophoresis on a 15% acrylamide gel or a 6% Nusieve gel, we measured the size of the obtained fragments and determined the number of CAG repeats since a 282 basepair fragment corresponds to 21 CAG. We previously showed that the number of CAG repeats within the AR gene exon 1 in 23 families with complete or partial androgen insensitivity syndrome was 19 +/- 4. By this method, we detected heterozygosity in 50% of the mothers. We present here 2 exclusion prenatal diagnoses using exon 1 polymorphism of the AR gene. Family A presented a boy with a severe form of partial androgen insensitivity syndrome. The mother had 2 uncles with ambiguous genitalia. In family B, the affected child had a complete androgen insensitivity syndrome. In both families, analysis of the AR gene exon 1 polymorphism of the trophoblastic DNA showed the presence of the normal maternal X chromosome. The parents decided to carry on the gestation. In family A, the newborn had normal male external genitalia. In family B, sonography confirmed the presence of normal male external genitalia. These data suggest that exon 1 polymorphism of the AR gene could be prenatally used to predict androgen insensitivity syndrome.
J Steroid Biochem Mol Biol 1992 Dec
PMID:Prenatal prediction of androgen insensitivity syndrome using exon 1 polymorphism of the androgen receptor gene. 147 58

Expression of the RNA replicase domain of tobacco mosaic virus (TMV) and certain protein-coding regions in other plant viruses, is mediated by translational readthrough of a leaky UAG stop codon. It has been proposed that normal tobacco tyrosine tRNAs are able to read the UAG codon of TMV by non-conventional base-pairing but recent findings that stop codons can also be bypassed as a result of extended translocational shifts (tRNA hopping) have encouraged a re-examination. In light of the alternatives, we investigated the sequences flanking the leaky UAG codon using an in vivo assay in which bypass of the stop codon is coupled to the transient expression of beta-glucuronidase (GUS) reporter genes in tobacco protoplasts. Analysis of GUS constructions in which codons flanking the stop were altered allowed definition of the minimal sequence required for read through as UAG-CAA-UUA. The effects of all possible single-base mutations in the codons flanking the stop indicated that 3' contexts of the form CAR-YYA confer leakiness and that the 3' context permits read through of UAA and UGA stop codons as well as UAG. Our studies demonstrate a major role for the 3' context in the read through process and do not support a model in which teh UAG is bypassed exclusively as a result of anticodon-codon interactions. No evidence for tRNA hopping was obtained. The 3' context apparently represents a unique sequence element that affects translation termination.
J Mol Biol 1991 Mar 20
PMID:The signal for a leaky UAG stop codon in several plant viruses includes the two downstream codons. 201 Sep 14

Male F344 rats were fed N-[4-(5-nitro-2-furyl)-2-thiazolyl]formamide (FANFT) for up to 4 wk, then were given the basal diets (Prolab 3200 or AIN-76A) with or without 5% sodium saccharin for up to 100 wk. Eleven transitional cell carcinomas (TCCs), one undifferentiated carcinoma, and two sarcomas of the urinary bladder were examined for the expression of ras gene product, p21, by immunohistochemical staining and western blot analysis. Point mutation in codons 12 or 61 of the Ha-ras genes amplified by polymerase chain reaction was examined by a slot-blot screening procedure using allele-specific oligonucleotide probes. Immunohistochemical staining showed enhanced immunoreactivity with the antibody to ras p21 in seven TCCs and one undifferentiated carcinoma. Western blot analysis showed faster migration of the p21 band in 6 of 11 TCCs. Oligonucleotide hybridization revealed the point mutation in codon 12 of Ha-ras gene (GGA----GTA in 1 TCC) and in codon 61 (CAA----CGA in 5 TCCs and CAA----CTA in 1 TCC). Two mutations in codons 12 and 61 coexisted in one tumor, which were found to be present in different Ha-ras alleles. The incidence of Ha-ras gene mutations were similar in groups treated with (3 of 6) or without (3 of 8) sodium saccharin. These results suggest the involvement of activated Ha-ras gene in rat urinary bladder carcinogenesis induced by FANFT.
Mol Carcinog 1990
PMID:Point mutation in codons 12 and 61 of the Ha-ras gene in rat urinary bladder carcinomas induced by N-[4-(5-nitro-2-furyl)-2-thiazolyl]formamide. 220 84

Urothelial cell cultures generated from urinary bladders from a series of N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN)- or N-[4-(5-nitro-2-furanyl)-2-thiazolyl]formamide (FANFT)-treated Fischer 344 rats were examined for activating missense mutations in Ha-ras-1 genes. Our overall objective was to identify oncogene-activating mutations in this system and to determine what altered biological properties correlate with such genetic changes. The urinary bladders from the treated animals showed a spectrum of histopathologies, from simple hyperplasia to transitional cell carcinoma (TCC). Using restriction analysis, oligonucleotide hybridization, and DNA sequencing, we found that approximately 20% (3/14) of the bladder cell cultures had acquired oncogenic single-base substitutions in codon 61 of Ha-ras-1 genes (CAA----AAA or CGA). The donor bladder lesions for these three cultures, which also harbored the same ras-activating mutations, were all classified as stage A or B TCCs. However, four other TCCs also arising in this series were found to have normal Ha-ras genes. Whereas approximately half of the bladder cultures derived from the carcinogen-treated rats were nontumorigenic in athymic mice, the three cultures containing ras oncogenes were all highly tumorigenic (forming tumors within 5 wk of injection into athymic mice). These cultures also displayed a high degree of anchorage-independent growth and NIH 3T3-transforming activity in gene transfer assays. The nontumorigenic cultures were derived from bladder lesions that included three hyperplasias and three stage A TCCs. We conclude that ras-activating missense mutations were present in a malignant subset of bladder lesions induced by BBN or FANFT, but most of the lesions in this system appeared to involve genetic alterations elsewhere. Thus other oncogenes besides activated Ha-ras may apparently be associated with the same bladder histopathologies and transformation markers.
Mol Carcinog 1990
PMID:Activating missense mutations in Ha-ras-1 genes in a malignant subset of bladder lesions induced by N-butyl-N-(4-hydroxybutyl)nitrosamine or N-[4-(5-nitro-2-furanyl)-2-thiazolyl]formamide. 227 34

Three okadaic acid class tumor promoters, okadaic acid, dinophysistoxin-1, and calyculin A, have potent tumor-promoting activity in two-stage carcinogenesis experiments on mouse skin. DNA isolated from tumors induced by 7,12-dimethylbenz[a]anthracene (DMBA) and each of these tumor promoters revealed the same mutation at the second nucleotide of codon 61 (CAA----CTA) in the c-Ha-ras gene, determined by the polymerase chain reaction procedure and DNA sequencing. Three potent 12-O-tetradecanoylphorbol-13-acetate (TPA)-type tumor promoters, TPA, teleocidin, and aplysiatoxin, showed the same effects. These results provide strong evidence that this mutation in the c-Ha-ras gene is due to a direct effect of DMBA rather than a selective effect of specific tumor promoters.
Mol Carcinog 1989
PMID:Codon 61 mutations in the c-Harvey-ras gene in mouse skin tumors induced by 7,12-dimethylbenz[a]anthracene plus okadaic acid class tumor promoters. 250 60

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.
Mol Gen Genet 1989 Sep
PMID:Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine. 251 21

The complete DNA sequence of the Micrococcus luteus spectinomycin (spc) operon and its adjacent regions has been determined. The sequence has revealed the presence of genes that are homologous to those of the Escherichia coli ribosomal and related proteins, L14, L24, L5, S8, L6, L18, S5, L30, L15, and secretion protein Y (sec Y), and the gene for adenylate kinase (adk). The gene arrangement in the spc operon is essentially the same as that of E. coli except for the absence in the M. luteus spc operon of the genes for S14 and X protein that exist in the E. coli spc operon. SecY and adk seem to be composed of another operon (adk operon) with at least an open reading frame. The deduced amino acid sequences for these ribosomal proteins are well conserved among the two species (40-65% identity). Reflecting the high genomic guanine and cytosine (GC) content of M. luteus (74%), the codon usage of the genes is extremely biased toward use of G and C, about 94% of the codon third positions being G or C. Seven codons, AUA, AAA, AGA, UUA, GUA, CUA, and CAA, all of which have A at the codon third positions, are completely absent in the M. luteus genes examined. Out of 11 genes in the M. luteus spc and adk operons, 5 (10) use GUG (UGA) and 6 (1) use AUG (UAA) as an initiation (termination) codon.
J Mol Evol 1989 Nov
PMID:Spectinomycin operon of Micrococcus luteus: evolutionary implications of organization and novel codon usage. 253 72


1 2 3 4 5 6 7 8 9 10 Next >>