Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.
Mol Cell Biol 1992 Sep
PMID:Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression. 150 12

We have studied the effect of acrylonitrile on the transcription of specific genes of Saccharomyces cerevisiae. The results presented demonstrate that ACN disturbs the coordinated response of ribosomal protein genes and causes a dramatic induction of the LEU2 gene, which might be due to metabolites of ACN.
Mol Gen Genet 1986 Feb
PMID:Effect of acrylonitrile on the transcription of specific genes in Saccharomyces cerevisiae. 351 94

We have cloned a nuclear gene from the marine red alga Gracilaria verrucosa that encodes the complete 779 amino-acid mitochondrial aconitase (m-ACN), the first characterized from a photosynthetic organism. The N-terminal 28 deduced amino acids are predicted to constitute the mitochondrial transit peptide, the first described from a red alga. Putative transcriptional cis-acting elements were identified in the upstream untranslated region. The G. verrucosa m-ACN gene (m-ACN) is present in a single copy and is located ca. 1.5 kb upstream from the single-copy polyubiquitin gene. The single spliceosomal intron is located near the 5' end of the region encoding the mature m-ACN in precisely the same location and phase as intron 2 in Caenorhabditis elegans m-ACN; sequences at its 3' and 5' splice junctions and at the predicted lariat branch point conform well to the eukaryote consensus sequences. Multiple protein-sequence alignment of m-ACN, bacterial aconitase (b-ACN) and iron-responsive element-binding protein (IRE-BP), and phylogenetic analyses, revealed that m-ACN does not share a recent common ancestry with either b-ACN or IRE-BP.
Plant Mol Biol 1995 Jul
PMID:Characterization of the nuclear gene encoding mitochondrial aconitase in the marine red alga Gracilaria verrucosa. 764 96

Apolipoprotein E (apo E) exists in three allelic, functionally distinct isoforms (apo E2, E3 and E4). Recent work has suggested that apo-E-dependent uptake of lipoproteins may play important roles in the development and maintenance of the nervous system and in the responses to both peripheral and central nervous system injury. If apo-E-mediated transport of lipids were a rate-limiting step in these processes, one might expect that the functional differences between the alleles would be associated with varying predispositions to neurodegenerative and demyelinating diseases. Thus, we looked for an association between particular apo E genotypes and susceptibility to multiple sclerosis and Parkinson's disease. If apo-E-mediated cholesterol uptake were limiting in neuronal growth, one might also expect that apo E2 alleles would slow CNS tumour growth. Accordingly, apo E genotypes were investigated in individuals with sporadic vestibular schwannomas and neurofibromatosis type 2 (NF-2). No significant alteration in the apo E allele distributions was observed in any of these conditions, nor did the apo E genotypes correlate with disease severity. However, we confirmed the previous findings of an over-representation of the apo E4 allele in autopsy-diagnosed late-onset Alzheimer's disease patients. In addition, our data supported the recent observations that apo E2 may be associated with a protective effect for late-onset Alzheimer's disease. These contrasting risks associated with the apo E2 and E4 alleles strengthen the suggestions that this gene is directly involved in the pathogenesis of Alzheimer's disease.
Mol Cell Probes 1994 Dec
PMID:Apo E genotypes in multiple sclerosis, Parkinson's disease, schwannomas and late-onset Alzheimer's disease. 770 Feb 74

Schwannomas are common tumors of the nervous system and are frequently found in patients with neurofibromatosis (NF) 2. Although loss of heterozygosity in NF2 tumors suggests that the NF2 gene functions as a tumor suppressor gene, the NF2 gene shows amino acid sequence homology to structural proteins in one of which dominantly acting mutations have been described. We performed a mutational analysis in 30 vestibular schwannomas and examined the effect of mutations on the NF2 protein. We detected 18 mutations in 30 vestibular schwannomas of which seven contained loss or mutation of both NF2 alleles. Most mutations were predicted to result in a truncated protein. Mutational hot spots were not identified. Immunocytochemical studies using antibodies to the NF2 protein showed complete absence of staining in tumor Schwann cells, whereas staining was observed in normal vestibular nerve. These data indicate that loss of NF2 protein function is a necessary step in schwannoma pathogenesis and that the NF2 gene functions as a recessive tumor suppressor gene.
Hum Mol Genet 1994 Jun
PMID:Mutations of the neurofibromatosis type 2 gene and lack of the gene product in vestibular schwannomas. 795 Dec 31

We previously described a patient with neurofibromatosis type 2 (NF2) who showed a constitutional balanced translocation, t(4;22). To characterize the breakpoint on chromosome 22 in this patient in relation to a candidate gene (NF2) responsible for NF2, we analyzed DNAs from this patient and her parents using parts of NF2 cDNA as probes. Southern analyses and DNA sequencing revealed that the chromosome 22 breakpoint in this patient lies within the intron between exons 14 and 15 of NF2. The results lend support to the conclusion that NF2 is the gene responsible for the CNS form of neurofibromatosis.
Hum Mol Genet 1994 Jun
PMID:Characterization of the translocation breakpoint on chromosome 22q12.2 in a patient with neurofibromatosis type 2 (NF2). 795 Dec 41

Mutations in the neurofibromatosis type 2 (NF2) gene predispose individuals to the development of nervous system tumors and ocular abnormalities. The NF2 gene product, schwannomin, is a member of a superfamily of proteins thought to link cytoskeletal elements to cell membrane components. These proteins share significant homologies in the N-terminal and alpha-helical domains, but diverge in the C-terminus. During our efforts to characterize mouse NF2 transcripts, we identified four different transcripts by cDNA analysis and reverse-transcribed PCR that contained different sequences in the 3' end of the coding sequences. In human cell lines three isoforms encoding two distinct schwannomins were detected. The mouse and human transcripts containing 61 and 60 bp inserts, respectively, have not been previously described. The isoforms encode schwannomins with significantly altered C-termini and were expressed at different relative levels in adult mouse tissues and during mouse embryogenesis. These results suggest that schwannomin isoforms have distinct functional roles and predict the existence of human mutations involving the C-terminus of schwannomin.
Hum Mol Genet 1994 Jul
PMID:Alternative transcripts in the mouse neurofibromatosis type 2 (NF2) gene are conserved and code for schwannomins with distinct C-terminal domains. 798 75

A 140 kb homozygous deletion from 22q12 in one meningioma directed us towards the cloning and characterization of a new member of the human beta-adaptin gene family (named BAM22). Adaptins are essential for the formation of clathrin coated vesicles in the course of intracellular transport of receptor-ligand complexes. The BAM22 gene is totally inactivated in the tumor with homozygous deletion. Northern blot analysis of 70 sporadic meningiomas showed specific loss of expression in 8 tumors, suggesting inactivation of BAM22. Based on this, we propose BAM22 as a second chromosome 22 locus important in meningioma development, after the neurofibromatosis type 2 gene.
Hum Mol Genet 1994 Aug
PMID:Characterization of a new member of the human beta-adaptin gene family from chromosome 22q12, a candidate meningioma gene. 798 21

Vestibular schwannoma occurs both as a sporadic tumour and in the dominantly inherited familial cancer syndrome neurofibromatosis type 2 (NF2). The gene for NF2 has recently been isolated on chromosome 22, and the demonstration of inactivating germline mutations in NF2 patients and NF2 associated tumours suggests that it act as a tumour suppressor. We have investigated 85 sporadic and 2 NF2 associated vestibular schwannomas, and one vagal schwannoma for chromosome 22 allele loss and NF2 gene mutations. A further 7 vestibular schwannomas were investigated for NF2 mutations only. Chromosome 22 allele loss was detected in 34 of 87 vestibular schwannomas and in the vagal nerve schwannoma. Six exons of the NF2 gene were investigated by SSCP analysis in all 95 tumours. Somatic NF2 gene mutations were detected in 13 non-familial vestibular schwannomas and in one of the NF2 vestibular schwannomas. Seven non-familial tumours with an NF2 gene mutation also displayed a chromosome 22 allele loss. Thirteen of the mutations were predicted to produce truncation of the NF2 protein. These results suggest that somatic mutations of the NF2 tumour suppressor gene are a critical step in the pathogenesis of both familial and non-familial vestibular schwannoma and that the mechanism of tumourigenesis complies with a 'two-hit' mutation model.
Hum Mol Genet 1994 Feb
PMID:Somatic NF2 gene mutations in familial and non-familial vestibular schwannoma. 800 7

The recently isolated gene for neurofibromatosis type 2 (NF2) encodes a 595 amino acid protein, named merlin, which is related to the cytoskeleton-associated proteins moesin, ezrin and radixin. To identify evolutionarily conserved regions and to provide sequence information necessary for the establishment of a mouse model for NF2, we have determined the cDNA sequence of the mouse NF2 tumor suppressor gene, and mapped it in the mouse genome. Mouse merlin is a 596 amino acid protein, 98% identical to human merlin, but one amino acid longer due to the insertion of a proline residue near the C-terminus. Of the nine amino acid differences between mouse and humans, seven occur in the C-terminal 20% of the protein, far from the protein 4.1 domain that defines this family. Two of the NF2 cDNA clones reveal evidence of alternative splicing events that alter the predicted merlin product, one removing a 45 amino acid segment from the middle section of the protein and the other changing the C-terminus. The existence of several different forms of merlin potentially with different primary roles will complicate the identification of the precise function that must be disrupted to cause the NF2-associated tumors. The mouse NF2 homologue maps to Chr 11, in a region homologous to human Chr 22, but devoid of any mouse mutations which could be models of the human disorder.
Hum Mol Genet 1994 Mar
PMID:The murine NF2 homologue encodes a highly conserved merlin protein with alternative forms. 801 52


1 2 3 4 5 6 7 8 9 10 Next >>