Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

This study extends our analysis of rabbit recombinant Sp17 (rSp17) by examining whether rSp17 synthesized in transfected COS cells will show a particular localization within the cell and whether the COS cell will bind with zona pellucida. We show, using the crosslinking, reagent DSS that rSp17 can bind to rabbit zona glycoprotein R45 or R55.
Mol Reprod Dev 1995 Jan
PMID:Expression of the rabbit sperm protein Sp17 in COS cells and interaction of recombinant Sp17 with the rabbit zona pellucida. 770 69

Collectively, the inherited disorders of peripheral nerves represent a common group of neurologic diseases. Charcot-Marie-Tooth neuropathy type 1 (CMT1) is a genetically heterogeneous group of chronic demyelinating polyneuropathies with loci mapping to chromosome 17 (CMT1A), chromosome 1 (CMT1B), the X chromosome (CMTX) and to another unknown autosome (CMT1C). CMT1A is most often associated with a tandem 1.5 megabase (Mb) duplication in chromosome 17p11.2-12, or in rare patients may result from a point mutation in the peripheral myelin protein-22 (PMP22) gene. CMT1B is associated with point mutations in the myelin protein zero (P0) gene. The molecular defect in CMT1C is unknown. X-linked Charcot-Marie-Tooth neuropathy (CMTX) is associated with mutations in the connexin32 gene. Charcot-Marie-Tooth neuropathy type II (CMT2) is an axonal neuropathy, also of undetermined cause. One form of CMT2 maps to chromosome 1p36 (CMT2A). Dejerine-Sottas disease, also called hereditary motor and sensory neuropathy type III (HMSNIII), is a severe, infantile onset demyelinating polyneuropathy syndrome that may be associated with point mutations in either the PMP22 gene of the P0 gene. Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant disorder that results in a recurrent, episodic demyelinating neuropathy. HNPP is associated with a 1.5 Mb deletion in chromosome 17p11.2-12 and may result from reduced expression of the PMP22 gene. CMT1A and HNPP are apparent reciprocal duplication/deletion syndromes originating from unequal crossover during germ cell meiosis.
Hum Mol Genet 1994
PMID:Molecular genetics of Charcot-Marie-Tooth disease and related neuropathies. 784 45

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.
Mol Biol (Mosk)
PMID:[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]. 824 27

The IGFs have been implicated in the development of the intestinal tract. We have studied the human colon carcinoma cell line CaCo-2 to gain more insight into the function of the IGFs in the gut. [125I]IGF-I and -II bound specifically to CaCo-2 cells as measured in competitive binding experiments. The existence of IGF-I receptors was further demonstrated by affinity crosslinking studies using DSS as the crosslinking agent. Western blotting of CaCo-2 cell extracts using an anti IGF-II/M6P receptor antiserum provided additional evidence for the expression of the IGF-II/M6P receptor. In addition, Northern blotting experiments showed specific IGF-I receptor and IGF-II/M6P receptor gene expression in CaCo-2 cells. An 11 kb band was visualized with a 614 bp PstI IGF-I receptor probe on autoradiographs. Hybridization with a 663 bp IGF-II/M6P receptor probe yielded a 9 kb RNA species. Analysis of CaCo-2 cell RNA using solution hybridization/RNase protection assays yielded two protected fragments, approximately 379 bases in length, with a 394 base IGF-I receptor riboprobe and a 250 base protected fragment with a 260 base IGF-II/M6P receptor riboprobe. In a subset of experiments a PstI 700 base fragment of the IGF-I cDNA and a 554 base SalI fragment of the IGF-II cDNA were used for hybridization: no hybridization was detected with the IGF-I probe. However, using the [32P]IGF-II probe bands at 6.0 and 5.0 kb were labeled in Northern blotting experiments. Analysis of CaCo-2 cell RNA using solution hybridization/RNase protection assays yielded a 289 base protected fragment and a faint 534 base species with a 556 base human IGF-II riboprobe. In addition, IGF-II immunoreactivity was measured in CaCo-2 cell-conditioned medium using an IGF-binding protein blocked radioimmunoassay. CaCo-2 cell-conditioned medium contained 5-15 ng/ml IGF-II immunoreactivity. In conclusion, (1) CaCo-2 cells express both IGF-I receptor mRNA and IGF-II/M6P receptor mRNA and contain functional IGF-I receptor and IGF-II/M6P receptor protein. (2) CaCo-2 cells express IGF-II mRNA and secrete IGF-II immunoreactivity. We hypothesize that in human colon carcinoma cells IGF-II could act as an autocrine growth factor or alternatively could serve as a regulatory factor during differentiation.
Mol Cell Endocrinol 1994 May
PMID:Human colon carcinoma cells (CaCo-2) synthesize IGF-II and express IGF-I receptors and IGF-II/M6P receptors. 939 46

The identification of XY females carrying a duplication of a region of the X chromosome (Xp21) led to the hypothesis that a double dose of a gene in the duplicated region causes sex reversal (DSS; dosage sensitive sex reversal). A gene isolated from this region, named DAX-1 (DSS-AHC critical region on the X), encodes a new member of the nuclear hormone receptor family. Here, we describe the isolation of porcine Dax-1 and the analysis of its pattern of expression both during foetal development and in several adult tissues. Dax-1 is expressed in the adrenals, the pituitary gland and the gonads at various stages of differentiation. In gonads, Dax-1 expression starts between 21 and 23 days post coitum in both XX and XY urogenital ridges then continues to be expressed until adult age. The expression in these tissues indicates the involvement of DAX-1 in the development and the function of the reproductive system at multiple levels.
Mol Cell Endocrinol 1997 Nov 30
PMID:Porcine Dax-1 gene: isolation and expression during gonadal development. 945 40

The early growth response 2 gene ( EGR2 ) is a Cys2His2zinc finger transcription factor which is thought to play a role in the regulation of peripheral nervous system myelination. This idea is based partly on the phenotype of homozygous Krox20 ( Egr2 ) knockout mice, which display hypomyelination of the PNS and a block of Schwann cells at an early stage of differentiation. Mutations in the human EGR2 gene have recently been associated with the inherited peripheral neuropathies Charcot-Marie-Tooth type 1, Dejerine-Sottas syndrome and congenital hypomyelinating neuropathy. Three of the four EGR2 mutations are dominant and occur within the zinc finger DNA-binding domain. The fourth mutation is recessive and affects the inhibitory domain (R1) that binds the NAB transcriptional co-repressors. A combination of DNA-binding assays and transcriptional analysis was used to determine the functional consequences of these mutations. The zinc finger mutations affect DNA binding and the amount of residual binding directly correlates with disease severity. The R1 domain mutation prevents interaction of EGR2 with the NAB co-repressors and thereby increases transcriptional activity. These data provide insight into the possible disease mechanisms underlying EGR2 mutations and the reason for varying severity and differences in inheritance patterns.
Hum Mol Genet 1999 Jul
PMID:Functional consequences of mutations in the early growth response 2 gene (EGR2) correlate with severity of human myelinopathies. 1036 70

The peripheral myelin protein 22 (PMP22) and the epithelial membrane proteins (EMP-1, -2, and -3) comprise a subfamily of small hydrophobic membrane proteins. The putative four-transmembrane domain structure as well as the genomic structure are highly conserved among family members. PMP22 and EMPs are expressed in many tissues, and functions in cell growth, differentiation, and apoptosis have been reported. EMP-1 is highly up-regulated during squamous differentiation and in certain tumors, and a role in tumorigenesis has been proposed. PMP22 is most highly expressed in peripheral nerves, where it is localized in the compact portion of myelin. It plays a crucial role in normal physiological and pathological processes in the peripheral nervous system. Progress in molecular genetics has revealed that genetic alterations in the PMP22 gene, including duplications, deletions, and point mutations, are responsible for several forms of hereditary peripheral neuropathies, including Charcot-Marie-Tooth disease type 1A (CMT1A), Dejerine-Sottas syndrome (DDS), and hereditary neuropathy with liability to pressure palsies (HNPP). The natural mouse mutants Trembler and Trembler-J contain a missense mutation in different hydrophobic domains of PMP22, resulting in demyelination and Schwann cell proliferation. Transgenic mice carrying many copies of the PMP22 gene and PMP22-null mice display a variety of defects in the initial steps of myelination and/or maintenance of myelination, whereas no pathological alterations are detected in other tissues normally expressing PMP22. Further characterization of the interactions of PMP22 and EMPs with other proteins as well as their regulation will provide additional insight into their normal physiological function and their roles in disease and possibly will result in the development of therapeutic tools.
Prog Nucleic Acid Res Mol Biol 2000
PMID:The peripheral myelin protein 22 and epithelial membrane protein family. 1069 8

The rotational spectra of the HSS and DSS radicals were studied in selected regions between 331 and 883 GHz. The radicals were produced by discharging a gaseous mixture of hydrogen (or deuterium) and hydrogen sulfide in the cell. The observation of the b-type Q-branch and R-branch lines with K(a) = 2-1 and 3-2 for HSS and DSS, respectively, as well as the a-type R-branch lines allowed the improvement and the determination of the molecular constants among them (in MHz) We have reevaluated the harmonic force field of HSS and the ground state average and approximate equilibrium structural parameters. For the latter, we obtained r(HS) = 135.23 pm, r(SS) = 196.03 pm, and angle = 101.74 degrees. These results are compared with those from previous and own quantum chemical calculations as well as with results of related molecules. Copyright 2000 Academic Press.
J Mol Spectrosc 2000 Jan
PMID:Rotational Spectra of the Thiosulfeno Radical, HSS and DSS, between 0.3 and 0.9 THz. 1071 72

Gas3/PMP22 is a tetraspan membrane protein highly expressed in myelinating Schwann cells. Point mutations in the gas3/PMP22 gene account for the dominant inherited peripheral neuropathies Charcot-Marie-Tooth type 1A disease (CMT1A) and Dejerine-Sottas syndrome (DSS). Gas3/PMP22 can regulate apoptosis and cell spreading in cultured cells. Gas3/PMP22 point mutations, which are responsible for these diseases, are defective in this respect. In this report, we demonstrate that Gas3/PMP22-WT is exposed at the cell surface, while its point-mutated derivatives are intracellularly retained, colocalizing mainly with the endoplasmic reticulum (ER). The putative retrieval motif present in the carboxyl terminus of Gas3/PMP22 is not sufficient for the intracellular sequestration of its point-mutated forms. On the contrary, the introduction of a retrieval signal at the carboxyl terminus of Gas3/PMP22-WT leads to its intracellular accumulation, which is accompanied by a failure to trigger cell death as well as by changes in cell spreading. In addition, by substituting the Asn at position 41 required for N-glycosylation, we provide evidence that N-glycosylation is required for the full effect on cell spreading, but it is not necessary for triggering cell death. In conclusion, we suggest that the DSS and the CMT1A neuropathies derived from point mutations of Gas3/PMP22 might arise, at the molecular level, from a reduced exposure of Gas3/PMP22 at the cell surface, which is required to exert its biological functions.
Mol Biol Cell 2000 Sep
PMID:Exposure at the cell surface is required for gas3/PMP22 To regulate both cell death and cell spreading: implication for the Charcot-Marie-Tooth type 1A and Dejerine-Sottas diseases. 1098 89

Charcot-Marie-Tooth (CMT) disease is a heterogeneous group of inherited peripheral motor and sensory neuropathies characterized by chronic distal weakness with progressive muscular atrophy and sensory loss in the distal extremities. Inheritance can be autosomal dominant, X-linked or autosomal recessive (ARCMT). Recently, a locus responsible for a demyelinating form of ARCMT disease, named CMT4F, has been mapped on 19q13 in a large consanguineous Lebanese family. L- and S-periaxin are proteins of myelinating Schwann cells and homozygous periaxin-null mice display extensive demyelination of myelinated fibers in the peripheral nervous system, which suggests that the periaxin gene is a good candidate gene for an ARCMT disease. The human gene encoding the periaxins (PRX) was mapped to 19q13, in the CMT4F candidate interval. After characterizing the human PRX gene, we identified a nonsense R196X mutation in the Lebanese family which cosegregated with CMT. Histopathological and immunohistochemical analysis of a sural nerve biopsy of one patient revealed common features with the mouse mutant and the absence of L-periaxin from the myelin sheath. These data confirm the importance of the periaxin proteins to normal Schwann cell function and substantiate the utility of the periaxin-null mouse as a model of ARCMT disease.
Hum Mol Genet 2001 Feb 15
PMID:A mutation in periaxin is responsible for CMT4F, an autosomal recessive form of Charcot-Marie-Tooth disease. 1115 4


1 2 3 4 5 6 7 8 9 Next >>