Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P06889 (
Mol
)
630,302
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Sarah Luse (1959) reported over 30 years ago on the presence of a bridge connecting the axon to the myelin sheath in the central nervous system (CNS). This notion has not been accepted in the literature. Wolman (1992) found that the progress of demyelination in some viral diseases affecting the CNS
fits
the concept of Luse, as the process occurred primarily along the major dense line of myelin, which is in continuity with the cytoplasm of the oligodendroglial cell. Injection of Lucifer yellow (LY) and horseradish peroxidase (HRP) into the vitreous of guinea pigs, with and without iontophoresis, resulted in labeling of the nerve axons and myelin. Labeling of myelin by HRP occurred along the major dense line which indicated that a transient or permanent cytoplasmic bridge connects axons and myelin in the optic nerve.
Cell
Mol
Biol (Noisy-le-grand)
PMID:Does a cytoplasmic bridge connect the CNS axon with the inner loop of myelin? 128 45
Recent linkage studies located genes responsible for the low voltage EEG, benign neonatal
convulsions
and for the Fanconi anaemia to the vicinity of the VNTR marker CMM6 (D20S19). Physical mapping experiments using pulsefield electrophoresis in the distal part of chromosome 20q were chosen as a first step towards cloning of these genes. The observed pattern of shared fragments lead to the locus order 'tel-IP20K09-RMR6-CMM6-MS214-cen', which differs from previously reported genetic linkage maps. The physical intervals between these probes are markedly shorter compared with the genetic distances. Clusters of rare cutter sites around CMM6 point to at least four closely related CpG islands.
Hum
Mol
Genet 1992 Aug
PMID:D20S19, linked to low voltage EEG, benign neonatal convulsions, and Fanconi anaemia, maps to a region of enhanced recombination and is localized between CpG islands. 130 9
This paper analyzes the nucleotide sequences of three viruses: Kunjin, west Nile, and yellow fever. Each virus has one long open reading frame of greater than 10,200 nucleotides that codes for four structural and seven nonstructural genes. The Kunjin and west Nile viruses are the most closely related pair, when assessed on the basis of matches between their nucleotide sequences. As would be expected, the matching is least for bases at third-position codon sites and is greatest for second-position sites. Statistics are presented for the numbers of mismatches that are transitions or transversions. Nucleotide base usage is also reported. To each of the 33 virus-gene segments, nonhomogeneous Markov chain models have been fitted to describe the sequences of nucleotide bases. The models allow for different transition probabilities ("transition" is used in the mathematical sense here) and for different degrees of dependency, at the three sites in the codons. Reasonably satisfactory
fits
can be obtained for many of the genes by using models that are first order for both first- and second-position sites in the codon but that are second order for third-position sites. One consequence of such a model is that the correlation between one amino acid and the next is limited to the correlation of the last base of the former with the first base of the latter. Other consequences are that the model can (and does) prohibit the occurrence of stop codons within a gene and that subsequences of only first-position bases, or only third-position bases, are also first-order Markov chains. In theory, second-position subsequences may not be Markov chains at all. In practice, the data suggest that each of these subsequences is effectively a zero-order Markov chain, i.e., bases spaced three apart are statistically independent. Stationarity of nucleotide base distributions can be interpreted in either of two ways: (1) spatially along the sites or (2) temporally at each site. These interpretations must often be inconsistent, when the former allows for Markov dependence between adjacent sites whereas the latter assumes independence between sites. The inconsistency can be overcome, for these viruses, if subsequences at different codon positions are analyzed separately.
Mol
Biol Evol 1992 Jul
PMID:A stochastic analysis of three viral sequences. 132 21
An exhaustive computer-assisted analysis of the Moloney murine leukemia virus nucleotide sequence shows numerous deviations in the oligomeric distribution, suggesting three overlapping levels of a stepwise duplicative evolution. (1) The sequence
fits
the universal rule of TG/CT excess which has been proposed as the construction principle of all sequences, and maintains some degree of symmetry between the two complementary strands. (2) Oligomeric repeating units share a core consensus regularly scattered throughout the sequence. This consensus is not merely predictable from the doublet frequencies and codon usage, but could correspond to an intermediary stage in a so-called periodic-to-chaotic transition. (3) Probable stepwise local duplications could be accounted for by slippagelike mechanisms. Comparison with the human spumaretrovirus (HSRV) shows similar segments in the overrepresented oligomers of the two sequences. The intermediary stage of transition oligomeric repeating units is not so clearly suggested in HSRV, perhaps because of numerous stepwise local duplications. In any case, a common evolutionary origin for the two viruses is not ruled out.
J
Mol
Evol 1992 Nov
PMID:Mo-MuLV nucleotide sequence exhibits three levels of oligomeric repetitions, suggesting a stepwise molecular evolution. 133
Injection of N-methyl-D-aspartate (NMDA, 7.5 micrograms) kainate (1 microgram) or quisqualate (2 micrograms) into the rat dorsal hippocampus induced wet-dog shakes and
convulsions
. As shown by an in situ immunohistochemical analysis, 3 h after the excitatory amino acids injections the rats displayed a bilateral profound elevation of the proenkephalin and prodynorphin mRNA levels in dentate gyrus granule cells (2-3 or 1.5-2 fold higher than control levels, respectively). Pretreatment of rats with D-amino-phosphonovalerate (D-APV, 10 micrograms), a selective antagonist of NMDA receptor, prevented the behavioral and biochemical changes evoked by NMDA. The changes in the behavior and gene expression evoked by kainate or quisqualate were diminished in rats which received 6-cyano-7-nitroquinoxaline-2,3-dion (CNQX, 2 micrograms), a putative antagonist of quisqualate and kainate receptors. The study demonstrated that activation of NMDA, quisqualate or kainate receptors in the hippocampus induced seizures associated with a marked increase in the proenkephalin (PENK) and the prodynorphin (PDYN) gene expression in the rat dentate gyrus.
Brain Res
Mol
Brain Res 1992 Jan
PMID:The effects of excitatory amino acids on proenkephalin and prodynorphin mRNA levels in the hippocampal dentate gyrus of the rat; an in situ hybridization study. 134 33
The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J.
Mol
. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The
fits
were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.
...
PMID:Analysis of an RNA pseudoknot structure by CD spectroscopy. 137 72
Normally-polarized tissue from the human atrial myocardium usually exhibits a diastolic depolarization phase which can be suppressed reversibly by Cs+ or enhanced by inhibiting the inward rectifier K+ current, iK1, with Ba2+. (Escande et al., 1986). Because the suppression of the diastolic slope by Cs+ leads to a hyperpolarization of the cell membrane at the end of the diastolic phase, it was suggested that Cs+ might inhibit an inward current responsible for diastolic depolarization. Among the ionic mechanisms underlying the diastolic depolarization phase of cardiac tissues, the hyperpolarization-activated inward current, if,
fits
well to explain the small diastolic slope of human atrial fibres. In other preparations, this inward current carried both by Na+ and K+ ions is rapidly deactivated during the action potential and entirely blocked by millimolar concentrations of Cs+ (DiFrancesco 1981; DiFrancesco, et al., 1986; Kokubun et al., 1982; Callewaert et al., 1984; Denyer and Brown, 1990). Such a current in human myocardial cells has not been characterized so far although its existence in human atrial trabeculae was previously reported in an abstract (Carmeliet, 1984). In the present study, we describe an inward current which activates upon hyperpolarization in patch-clamped single human atrial cells and shares similar characteristics with the if pacemaker current described in unicellular and intact preparations of mammalian cardiac tissues.
J
Mol
Cell Cardiol 1992 May
PMID:A hyperpolarization-activated inward current in human myocardial cells. 137 2
We evaluated the effects of beraprost Na (Sodium (+-)-(1R*,2R*, 3aS*,8bS*)-2,3,3a,8b-tetrahydro-2-hydroxy-1-[(E)-(3S*)-3- hyd roxy-4-methyl-1- octen-6-ynyl]-1H-cyclopenta[b]benzofuran-5-butylate, beraprost), a stable and orally active prostacyclin (PGI2) analog with potent antiplatelet and vasodilating properties, on two stroke models, namely sudden death induced by arachidonate (AA) in rabbits and spontaneous stroke in stroke-prone spontaneously hypertensive rats (SHRSP). In the AA-induced sudden death model, 30 min after beraprost administration (1 or 3 mg/kg, po), AA was injected into the rabbit internal carotid artery, and incidence of
convulsion
and sudden death were assessed. Beraprost decreased both incidence of
convulsion
and mortality of rabbits. In SHRSP, orally administered beraprost (100 micrograms/kg, twice a day from 56-385 d of age) improved survival rate and decreased incidence of stroke. Preventive effects of beraprost on the two stroke models may have been caused mainly by the improvement of cerebral circulation. These results indicate that beraprost may have potential in the treatment and/or prevention of the cerebral circulatory disorders.
Mol
Chem Neuropathol 1992 Aug
PMID:The effects of beraprost Na, a stable prostacyclin analog, on animal models of stroke. 138 52
Hydrostatic pressure has been used to convert cytochrome P-450camphor to cytochrome P-420. The latter is an inactivated but soluble and undenaturated form of cytochrome P-450camphor. Using camphor analogues as probes of the active site we show that the inactivation volume change is directly correlated to the initial degree of hydration of the heme pocket. The values range between -73 ml/mol and -197 ml/mol [Di Primo, C., Hui Bon Hoa, G., Douzou, P. & Sligar, S. G. (1990) Eur. J. Biochem. 193, 383-386] for a totally hydrated (substrate-free, low-spin, six coordinated heme iron) and a non-hydrated (camphor-bound, high-spin, five coordinated heme iron) heme pocket. These results suggest that the larger value, -197 ml/mol, for the inactivation volume change is due to a hydration change of the heme pocket resulting from the displacement of the substrate during the compression and the subsequent entrance of water molecules. Similarly, the stability of the protein against compression is correlated with water accessibility to the active site. Increase in substrate mobility by loss of specific interactions with both regions of well defined secondary structure of cytochrome P-450camphor results in an increase of water accessibility and decrease of stability. Thus for camphor and adamantanone which strongly interact with the protein and exclude water from the active site [Poulos, T. L., Finzel, B. C. & Howard, A. J. (1987) J.
Mol
. Biol. 195, 687-700; Raag, R. & Poulos, T. L. (1989) Biochemistry 28, 917-922] the increase in stability compared to the free protein is roughly 30 kJ/mol at 20 degrees C. With smaller substrates such as norcamphor, which loosely
fits
into the active site and does not completely exclude water [Raag, R. & Poulos, T. L. (1989) Biochemistry 28, 917-922], the increase in stability is only 7 kJ/mol. Finally these results suggest that cytochrome P-420 induced by hydrostatic pressure is a unique form where the active site is hydrated and camphor is displaced from its binding site.
...
PMID:Heme-pocket-hydration change during the inactivation of cytochrome P-450camphor by hydrostatic pressure. 142 65
Computer graphics and energy calculations were employed to examine the relative fit of progesterone and its major biosynthetic precursors and inactive metabolites into partially unwound double stranded DNA. Progesterone was found to be the best fitting molecule; moreover, it was the only compound which exhibited full stereochemical complementarity by inserting completely between base pairs and forming optimal hydrogen bonds with both deoxyribose-phosphate backbones. Intermediates in each step of the biosynthetic and degradation pathways were progressively increasing and decreasing
fits
into DNA, respectively. When the
fits
of various possible stereoisomers were examined, the positions of functional groups manifest in the known biosynthetic precursors were found to provide the best possible fitting structures. Conversely, the positions of functional groups of known inactive metabolites provided the worst possible fitting structures. These findings coupled with previous reports showing that the specific biological function assigned to each class of steroid hormone correlates with the formation of a unique pattern of donor/acceptor linkages confirms that hormonal structures are indeed rare in their capacity to form "lock and key" complexes with DNA. Given that all possible linkages to DNA are not yet accounted for, the existence of other naturally occurring compounds with salient biological function is predicted.
J Steroid Biochem
Mol
Biol 1992 Aug
PMID:The metabolic pathways for hormonal steroids appear to be reflected in the stereochemistry of DNA. 150 6
1
2
3
4
5
6
7
8
9
10
Next >>