Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P06889 (Mol)
 630,302 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

While t(1;19) and t(8;14) have been reported singly in pre-B-ALL and Burkitt's lymphoma, respectively, the occurrence of both translocations simultaneously in the same patient is rare. Indeed, a review of the English literature from 1966 to 1999 revealed no case reports with these findings. We report here an 88-year-old patient who was clinically diagnosed to have chronic lymphocytic leukemia and who carried both translocations in her peripheral blood cells. The patient refused to give consent for a bone marrow sample, the preferred tissue for study. The patient's clinical findings are discussed, although the relationship between the clinical information and cytogenetic findings, if any, is not known. Study of additional cases identical to ours will be helpful in determining the correlation, if any, between the patient's phenotype and the occurrence of the two translocations.
Exp Mol Pathol 1999 Aug
PMID:Occurrence of both t(1;19) and t(8;14) in a patient with chronic lymphocytic leukemia. 1048 42

Recombinant DNA technology makes it possible to genetically fuse V genes or cytokines to toxin domains, resulting in immunotherapeutics for selective destruction of tumor cells. Since recombinant immunotoxins can be easily manipulated in terms of affinity or cytotoxic potency and produced in large quantities, we have developed a new CD30 ligand-based fusion toxin (CD30L-ETA'). Human CD30L cDNA was ligated into a pET-based expression plasmid and thereby fused to a modified Pseudomonas aeruginosa exotoxin A (ETA') lacking its cell-binding domain I. After IPTG-indiced expression in E. coli strain BL21(DE3), the 60 kDa His-tagged fusion protein (CD30L-ETA') was isolated from inclusion bodies. Denatured protein was renatured in the presence of 0.4 M arginine and a glutathione redox system. Refolded protein was purified and concentrated by ion-exchange chromatography on a HiTrap Q column. The binding properties of CD30L-ETA' were evaluated by competitive ELISA, immunohistochemical staining, and FACS analysis on CD30-expressing cells. The in vitro toxicity of the fusion protein was then tested on the CD30+ Hodgkin-derived cell line L540cy and the Burkitt's lymphoma cell line BL38. CD30L-ETA' exhibited specific cytotoxicity against L540cy cells (IC50 = 24 ng/ml) as determined by [3H]leucine uptake assays. This is the first report on the specificity and cytotoxic potency of a chimeric CD30L fusion toxin against Hodgkin's disease-derived cells.
Cytokines Cell Mol Ther 1999 Jun
PMID:CD30L-ETA': a new recombinant immunotoxin based on the CD30 ligand for possible use against human lymphoma. 1051 79

The exquisite sensitivity of the Burkitt's lymphoma (BL)-derived cell line Daudi to type I interferons has not previously been explained. Here we show that expression of an Epstein-Barr virus (EBV) transcript, designated D-HIT (Y. Gao et al., J. Virol. 71:84-94, 1997), correlates with the sensitivity of different Daudi cell isolates (or that of other EBV-carrying cells, where known) to alpha interferon (IFN-alpha). D-HIT, transcribed from a GC-rich repetitive region (IR4) of the viral genome, is highly structured, responding to RNase digestion in a manner akin to double-stranded RNA. Comparing EBV-carrying BL cell lines with differing responses to IFN-alpha, we found the protein levels of the dsRNA-activated kinase, PKR, to be similar, whereas the levels of the autophosphorylated active form of PKR varied in a manner that correlated with endogenous levels of D-HIT expression. In a classical in vitro kinase assay, addition of either poly(I)-poly(C) or an in vitro-transcribed D-HIT homolog stimulated the autophosphorylation activity of PKR from IFN-alpha-treated cells in both EBV-positive and EBV-negative B lymphocytes. By transfection experiments, these RNAs were shown to reduce cell proliferation and to sensitize otherwise relatively insensitive Raji cells to IFN-alpha. The data lead to a model wherein the D-HIT viral RNA also serves as a possible transcriptional activator of IFN-alpha or cellular genes regulated by this cytokine.
Mol Cell Biol 1999 Nov
PMID:Sensitivity of an epstein-barr virus-positive tumor line, Daudi, to alpha interferon correlates with expression of a GC-rich viral transcript. 1052 19

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.
Am J Respir Cell Mol Biol 1999 Dec
PMID:Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript. 1057 70

Dolastatin 10 is a highly cytotoxic antimitotic peptide in phase II clinical trials. Its cytotoxicity has been as much as 50-fold greater than that of vinblastine, despite quantitatively similar effects of the two drugs on tubulin polymerization. We compared uptake and efflux of radiolabeled dolastatin 10 and vinblastine in human Burkitt lymphoma CA46 cells to gain an understanding of the greater cytotoxicity of the peptide. In the Burkitt cells, dolastatin 10 was 20-fold more cytotoxic than vinblastine (IC(50) values, 50 pM and 1.0 nM). When drug uptake at 24 h was compared at IC(50) values of the two drugs, the intracellular concentrations were almost identical (50-100 nM). The accumulation factor observed for dolastatin 10 was 900 to 1800 versus 60 to 100 for vinblastine. The two drugs showed very divergent uptake kinetics, however. Vinblastine and dolastatin 10 reached maximum intracellular concentrations after 20 min and 6 h, respectively. Depletion of cellular ATP content did not alter the uptake of either drug, indicating passive uptake of both. When drug-preloaded cells were transferred to drug-free medium, there was no loss of dolastatin 10 for at least 2 h, whereas vinblastine exited the cells rapidly (approximate intracellular half-life, 10 min), with less than 10% of the initial drug remaining in the cells after the 2-h incubation. The potency of dolastatin 10 probably derives from its tenacious binding to tubulin, a property that in cells becomes translated into prolonged intracellular retention of the drug. Optimal clinical use of dolastatin 10 may require administration by infusion rather than by bolus.
Mol Pharmacol 2000 Jan
PMID:Sustained intracellular retention of dolastatin 10 causes its potent antimitotic activity. 1061 93

Several Epstein-Barr virus (EBV)-negative Burkitt lymphoma-derived cell lines (for example, BL41 and Ramos) are extremely sensitive to genotoxic drugs despite being functionally null for the tumor suppressor p53. They rapidly undergo apoptosis, largely from G(2)/M of the cell cycle. 5-bromo-2'-deoxyuridine labeling experiments showed that although the treated cells can pass through S phase, they are unable to complete cell division, suggesting that a G(2)/M checkpoint is activated. Surprisingly, latent infection of these genotoxin-sensitive cells with EBV protects them from both apoptosis and cell cycle arrest, allowing them to complete the division cycle. However, a comparison with EBV-immortalized B-lymphoblastoid cell lines (which have functional p53) showed that EBV does not block apoptosis per se but rather abrogates the activation of, or signalling from, the checkpoint in G(2)/M. Furthermore, analyses of BL41 and Ramos cells latently infected with P3HR1 mutant virus, which expresses only a subset of the latent viral genes, showed that LMP-1, the main antiapoptotic latent protein encoded by EBV, is not involved in the protection afforded here by viral infection. This conclusion was confirmed by analysis of clones of BL41 stably expressing LMP-1 from a transfected plasmid, which respond like the parental cell line. Although steady-state levels of Bcl-2 and related proteins varied between BL41 lines and clones, they did not change significantly during apoptosis, nor was the level of any of these anti- or proapoptotic proteins predictive of the outcome of treatment. We have demonstrated that a subset of EBV latent gene products can inactivate a cell cycle checkpoint for monitoring the fidelity and timing of cell division and therefore genomic integrity. This is likely to be important in EBV-associated growth transformation of B cells and perhaps tumorigenesis. Furthermore, this study suggests that EBV will be a unique tool for investigating the intimate relationship between cell cycle regulation and apoptosis.
Mol Cell Biol 2000 Feb
PMID:Epstein-Barr virus suppresses a G(2)/M checkpoint activated by genotoxins. 1064 20

Although the Myc family of transcription factors is upregulated in many human tumors, it is unclear which genes are targets for the deregulated Myc. Previous studies suggest that hamster and rat carbamoyl phosphate synthase, aspartate transcarbamylase, dihydroorotase Cad genes are regulated by c-Myc. In fact, of all putative target genes thought to be activated by c-Myc, only the Cad gene showed loss of growth regulation in rat cells nullizygous for c-Myc. However, it was unknown whether upregulation of CAD, which performs the first three rate-limiting steps of pyrimidine biosynthesis, contributes to c-Myc's role in human neoplasia. To explore this possibility, we cloned the human cad promoter. We found that c-Myc could bind to an E box in the human cad promoter in gel shift assays and that growth regulated transcription from the human cad promoter was dependent on this c-Myc binding site. However, the increased amount of c-Myc found in Burkitt's lymphoma cell lines did not lead to increased cad mRNA levels. Thus, we suggest that although c-Myc is clearly important for the normal transcriptional control of the cad promoter, it is unlikely that increased levels of CAD are important mediators of c-Myc-induced neoplasia. Therefore, an understanding of the mechanism by which overexpressed c-Myc contributes to the development of Burkitt's lymphoma requires the identification of additional c-Myc target genes.
Mol Carcinog 2000 Feb
PMID:CAD, a c-Myc target gene, is not deregulated in Burkitt's lymphoma cell lines. 1065 1

The c-Myc oncoprotein is a transcription factor which is a critical regulator of cellular proliferation. Deregulated expression of c-Myc is associated with many human cancers, including Burkitt's lymphoma. The c-Myc protein is normally degraded very rapidly with a half-life of 20 to 30 min. Here we demonstrate that proteolysis of c-Myc in vivo is mediated by the ubiquitin-proteasome pathway. Inhibition of proteasome activity blocks c-Myc degradation, and c-Myc is a substrate for ubiquitination in vivo. Furthermore, an increase in c-Myc stability occurs in mitotic cells and is associated with inhibited c-Myc ubiquitination. Deletion analysis was used to identify regions of the c-Myc protein which are required for rapid proteolysis. We found that a centrally located PEST sequence, amino acids 226 to 270, is necessary for rapid c-Myc degradation, but not for ubiquitination. Also, N-terminal sequences, located within the first 158 amino acids of c-Myc, are necessary for both efficient c-Myc ubiquitination and subsequent degradation. We found that c-Myc is significantly stabilized (two- to sixfold) in many Burkitt's lymphoma-derived cell lines, suggesting that aberrant c-Myc proteolysis may play a role in the pathogenesis of Burkitt's lymphoma. Finally, mutation of Thr-58, a major phosphorylation site in c-Myc and a mutational hot spot in Burkitt's lymphoma, increases c-Myc stability; however, mutation of c-Myc is not essential for stabilization in Burkitt's lymphoma cells.
Mol Cell Biol 2000 Apr
PMID:c-Myc proteolysis by the ubiquitin-proteasome pathway: stabilization of c-Myc in Burkitt's lymphoma cells. 1071 66

The Epstein-Barr virus (EBV) has been linked to the development of a variety of human malignancies, including Burkitt's lymphoma, Hodgkin's disease, nasopharyngeal carcinoma, some T cell lymphomas, post-transplant lymphoproliferative disease, and more recently, certain cancers of the stomach and smooth muscle. This review summarizes these associations and in particular the role of the viral latent genes in the transformation process.
Mol Pathol 1999 Dec
PMID:The Epstein-Barr virus and its association with human cancers. 1074 64

We have assayed the oncogenic, proliferative, and apoptotic activities of the frequent mutations that occur in the c-myc gene in Burkitt's lymphomas. Some alleles have a modest (50 to 60%) increase in transforming activity; however, the most frequent Burkitt's lymphoma allele (T58I) had an unexpected substantial decrease in transforming activity (85%). All alleles restored the proliferation function of c-Myc in cells that grow slowly due to a c-myc knockout. There was discordance for some alleles between apoptotic and oncogenic activities, but only the T58A allele had elevated transforming activity with a concomitant reduced apoptotic potential. We discovered a novel missense mutation, MycS71F, that had a very low apoptotic activity compared to wild-type Myc, yet this mutation has never been found in lymphomas, suggesting that there is no strong selection for antiapoptotic c-Myc alleles. MycS71F also induced very low levels of cytochrome c release from mitochondria, suggesting a mechanism of action for this mutation. Phosphopeptide mapping provided a biochemical basis for the dramatically different biological activities of the transformation-defective T58I and transformation-enhanced T58A c-Myc alleles. Furthermore, the antiapoptotic survival factor insulin-like growth factor 1 was found to suppress phosphorylation of T58, suggesting that the c-Myc transactivation domain is a direct target of survival signals.
Mol Cell Biol 2000 Jun
PMID:The c-Myc transactivation domain is a direct modulator of apoptotic versus proliferative signals. 1082 94


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>