Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P05231 (
interleukin-6
)
23,907
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Various plasma protein patterns following inflammation and metabolic stress were described since diagnostic value of ESR was established. This reactive dysproteinemia is now recognized to reflect the shift in hepatic proteosynthesis after the immunoendocrinological activation. Four main groups of mediators are necessary for expression of hepatic positive and negative acute phase proteins (APPs): first and second "wave' of proinflammatory cytokines, further glucocorticoids and growth factors including insulin. Actual data showing details of the immunological and endocrinological regulation of stress hepatocyte proteosynthesis are summarized and our own results are presented. We evaluated the diagnostic use of APPs in some defined clinical situations (neutropenic period after bone marrow transplantation, postoperative complications) and correlated APPs with the plasma levels of the circulating
interleukin-6
and cortisol. In another study, APPs, plasma and urinary TNF,
interleukin-6
, interleukin-8 and adhesive molecules
ICAM-1
, VCAM-1 were found to be significantly different in various glomerulopathies. Finally, our experimental data indicate the nitric oxide participation in oestradiol regulation of coeruloplasmin synthesis in rat.
...
PMID:[Acute phase proteins]. 871 1
Once thought as immunologically naive, cells from the central nervous system have been shown to become immunologically reactive and produce various substances including cytokines and adhesion molecules. Recent investigations have revealed that mRNAs of certain cytokines such as tumor necrosis factor, interleukin-1, and
interleukin-6
are expressed in the ischemic brain of the animals. Chemokines including CINC, MCP-1, and MIP-1, as well as adhesion molecules such as
ICAM-1
. ELAM and P-selectin were also found to be expressed. Although identification of the cells producing these cytokines were often difficult, neurons, endothelia, activated astrocytes and microglia/macrophages were the likely sources. The induction of these molecules in ischemic brain is time-locked and appears to be controlled in a highly regulated manner during the process of ischemic cascade. The functional role, interrelationship, and basic mechanism of action of these molecules are being increasingly recognized, while trials such as antiadhesion antibody molecules, growth factors, and anticytokine antibodies have been successful in reducing the neuronal damage in animals subjected to ischemic injury. Furthermore, changes of certain cytokines or adhesion molecules have been detected in the serum or cerebrospinal fluid of patients with stroke and related diseases suggesting that these molecules play a role in the pathogenesis of human stroke. Understanding of these cytokine-adhesion molecule cascades in the ischemic brain may allow us to develop new strategies for the treatment of stroke.
...
PMID:Cytokines and adhesion molecules in stroke and related diseases. 878 58
The authors have evaluated adhesive protein expression and cytokine production by human umbilical vein endothelial cells cultured in contact with polyethylene terephthalate (PET). ELAM-1,
ICAM-1
and VCAM-1 expression was determined by flow cytometry; the concentration of interleukin-1 alpha (IL-1 alpha),
interleukin-6
(
IL-6
), granulocyte colony stimulating factor (G-CSF) and granulocyte-macrophage colony stimulating factor (GM-CSF) in the supernatant was determined by enzyme immunoassay. The contact with PET determined a significant increase in ELAM-1 expression and insignificant increase in cytokine production, demonstrating that PET had a limited capability to stimulate endothelial cells in a pro-inflammatory sense.
...
PMID:Cytokine production and adhesive protein expression by endothelial cells after contact with polyethylene terephthalate. 890 40
Fibrous materials have the potential of being used for tissue scaffolding. The interaction of macrophages with fibres of various compositions and sizes was observed in vitro. The following materials were tested: individual gold fibres; woven fibres of polyester and nylon; non-woven fibres of polybutylene/polypropylene 80:20 and polyester. All fibres had diameters between 2 and 40 microns. At the end of the 24 h incubation time, culture media were retrieved for the assay of tumour necrosis factor alpha (TNF-alpha) and
interleukin-6
(
IL-6
), two cytokines secreted by activated macrophages. Fibre samples were processed for scanning electron microscopy (SEM), or for immunofluorescence labelling of the MAC-1 and
ICAM-1
cell surface markers. Confocal microscopy was used for the latter, which was performed with the woven and non-woven samples. None of the fibre samples induced significant amounts of TNF-alpha or
IL-6
secretion in the culture medium, suggesting that the cells did not activate this pathway. SEM on individual gold fibres showed that the fibre diameter had an effect on the morphology of the cells, namely on their extent of spreading. Larger fibres had a higher number of cells, which tended to cluster together without spreading extensively. When comparing woven and non-woven fibres, SEM showed that cells spread extensively on the woven fibres, whereas they tended to maintain their spherical shape on the non-woven fibres. Confocal microscopy demonstrated a difference between materials in the number of MAC-1 and
ICAM-1
positive cells. These results demonstrate that a combination of morphological, immune and biochemical markers can be used to distinguish the response of elicited macrophages to various materials. The cells appeared to be only moderately activated on all materials tested, with changes in their morphology but without increased secretion of cytokines. The measured responses imply interactions between nominal fibre composition and fibre diameter.
...
PMID:Interaction of macrophages with fibrous materials in vitro. 890 41
Bone marrow microvascular endothelial cells (BMEC) are a functional component of the bone marrow stroma and have been shown to release hematopoietic regulatory factors as well as to selectively adhere and support the proliferation and differentiation of CD34+ hematopoietic progenitors. An early passage of these cells was immortalized by transfection with a vector (pSVT) encoding the large T antigen of SV40. The transformed cell line (CDC/CU.BMEC-1) expresses the SV40 transcript, retains the primary cell expression of Ulex europeaus and vWF/ FVIII, and incorporates acetylated low-density lipoprotein. In addition, BMEC-1 mirrors the phenotype of the primary cells with only a few exceptions. Both cell populations express the cellular adhesion molecules
ICAM-1
and PECAM and also VCAM-1 and ELAM-1 after upregulation by tumor necrosis factor-alpha. The fibronectin receptor, hyaluronate receptor, collagen receptor, integrins VLA-alpha 3, VLA-alpha 4, and beta 4, endoglin, collagen IV, CD58, and CD61 are also expressed. The only differences are that BMEC-1 expresses higher levels of
ICAM-1
, CD58, CD34, CD36, and c-kit than the primary cells. The supernatants of primary cell and BMEC-1 contain stem cell factor,
interleukin-6
(
IL-6
), granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-1 alpha, IL-11, and G-CSF. The functional significance of these hematopoietic cytokines was demonstrated in transwell cultures. Both cell populations supported the expansion of progeny from CD34+ cell-enriched cord blood mononuclear cells suspended in the upper chamber. These characteristics, plus the fact that BMEC-1 can be maintained independently of exogenous growth factors and exhibit contact inhibition, indicate that this cell line can be used to further define the role of BMEC in hematopoiesis.
...
PMID:BMEC-1: a human bone marrow microvascular endothelial cell line with primary cell characteristics. 895 64
The neoplastic plasma cells of multiple myeloma differ from normal plasma cells and other B-cell malignancies by an almost exclusive homing to the bone marrow microenvironment which clearly provides the appropriate support, both physical and cytokine, to mediate clonal proliferation and terminal differentiation. Cellular adhesion molecules are involved in the homing of malignant plasma cells to the bone marrow, the production of growth factors and the recirculation of these tumour cells in the advanced stages of disease. Neoplastic plasma cells express H-CAM (CD44), VLA-4 (CD49d/CD29),
ICAM-1
(
CD54
), N-CAM (CD56) and LFA-3 (CD58). In addition VLA-5 (CD49e/CD29) expression seems to be related to cells with less proliferative potential and more potential for paraprotein production. In addition there are fundamental changes in the bone marrow stroma of patients with multiple myeloma including altered composition of the extracellular matrix, increased growth capability of the cellular elements and increased synthesis of
interleukin-6
and interleukin-3, which are features postulated to localise and promote growth of the circulating neoplastic progenitors in the bone marrow. However, the evidence to date does not fully explain the inter-relationship of the clonal B cells and the bone marrow stroma in patients with myeloma, including factors which trigger and facilitate the extravasation and recirculation of neoplastic plasma cells as seen in advanced disease.
...
PMID:The role of adhesion molecules in multiple myeloma. 898 Jun 13
The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of
ICAM-1
on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2,
interleukin-6
, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of
ICAM-1
on endothelial cells, resulting in exacerbation of vasculitis.
...
PMID:[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells]. 899 Sep 29
Six macrophage cell lines, each derived from a bone marrow macrophage colony grown in soft agar, were established by expansion of the macrophage clones in liquid culture until spontaneous transformation occurred. Four lines originated from the LPS(d) nonresponder mouse strain C3H/HeJ and two from the LPS(n) responder strain CBA/J. The cell lines adhered to plastic and glass surfaces and displayed typical macrophage functions such as phagocytosis and nonspecific esterase activity. Flow cytometry analyses showed that the lines expressed the macrophage surface markers CD11b, CD13, CD32/16, F4/80, and BM8 constitutively. A moderate expression of the adhesion receptor CD11a, but only a very low expression of its ligand
CD54
, was observed. A minor fraction of the cells in each line constitutively expressed MHC class II antigen, and its expression could be up-regulated in each cell line by treatment with interferon-gamma (IFN-gamma). Secretion of the inflammatory mediators nitric oxide (NO),
interleukin-6
(
IL-6
), and tumor necrosis factor alpha (TNF-alpha) after induction by three bacterial derivatives, heat-killed Salmonella typhimurium (HKS), lipopolysaccharide (LPS), and the Mycoplasma fermentans-derived amphiphilic lipid MDHM, were examined in detail. Not only did the lines differ in the amounts of mediators secreted in response to any one stimulus, but the doses of MDHM or LPS required for 50% maximal induction of NO varied up to 10-fold among the four LPS(d) cell lines, suggesting considerable functional heterogeneity between the clones. Secretion of large amounts of TNF-alpha was induced in all the cell lines by HKS. Although it could be shown that exogenously added TNF-alpha acted synergistically with IFN-gamma to induce NO release from the cell lines, an autocrine role for TNF-alpha during HKS-IFN-gamma induction of NO synthesis could not be substantiated. Neutralization of TNF-alpha with a specific antibody completely blocked NO induction by exogenous TNF-alpha but did not abrogate NO release either by HKS-IFN-gamma-induced cells or by macrophages treated with supernatant from an HKS-IFN-gamma-activated cell line. These results indicate that the clones are arrested in distinct stages of differentiation and retain some properties of normal untransformed macrophages. They should be helpful tools for investigations into macrophage function.
...
PMID:Characterization of clonally derived, spontaneously transformed bone marrow macrophage cell lines from lipopolysaccharide hyporesponsive LPS(d) and normal LPS(n) mice. 910 34
The microvascular endothelial cell (MVEC) is a major target of inflammatory cytokines overproduced in conditions such as sepsis and infectious diseases. We addressed the direct and indirect effects of tumor necrosis factor (TNF) on endothelial cells that can be relevant for the pathogenesis of septic shock, with particular attention to the acute respiratory distress syndrome (ARDS) and to cerebral malaria (CM). To identify functional and phenotypical changes occurring in MVEC during sepsis, we isolated these cells from the lungs of patients who died of ARDS. The constitutive expression of
ICAM-1
and, to a lesser extent, VCAM-1, CD14, and TNFR2 were significantly increased on MVEC isolated from ARDS patients compared with control MVEC, whereas ELAM-1 and TNFR1 were not increased. We found that lung MVEC from ARDS patients present a procoagulant profile and a higher production capacity of
interleukin-6
(
IL-6
) and IL-8 when compared with those from controls. As in pulmonary MVEC derived from ARDS patients, the only TNFR type found up-regulated in brain microvessels during CM was TNFR2. This increase in TNFR2 expression only occurred in CM-susceptible mice at the onset of the neurological syndrome. We therefore investigated the role of TNFR2 in the development of this brain pathology by comparing the incidence of CM in wild-type and TNF receptor knock-out mice. Unexpectedly, the genetic deficiency in TNFR2, but not in TNFR1, conferred protection against CM and its associated mortality. No
ICAM-1
up-regulation was detected in the brain of Tnfr2 knockout mice, indicating a close correlation between protection against CM-associated brain damage, absence of TNFR2, and absence of
ICAM-1
up-regulation in the brain. Our results in ARDS and CM indicate a specific up-regulation of TNFR2, but not of TNFR1, on lung and brain MVEC, respectively. This increased expression leads to a reduced sensitivity toward TNFR1-mediated phenomena, such as the sensitized TNF cytolytic activity on lung MVEC. In contrast, the sensitivity toward TNFR2-mediated effects, such as
ICAM-1
induction by membrane-bound TNF, is increased on brain and lung MVEC expressing increased levels of TNFR2. Therefore, the
ICAM-1
-inducing effect, rather than the direct cytotoxicity of inflammatory cytokines, such as TNF, appears to be crucial in ARDS and CM-induced endothelial damage, and TNFR2 seems to play an important role in this activity in vivo.
...
PMID:TNF receptors in the microvascular pathology of acute respiratory distress syndrome and cerebral malaria. 912 3
In order to study adhesion-molecule expression and its consequences for cellular recognition, the presence of adhesion molecules
ICAM-1
, VCAM-1, VLA-4, LFA-1, alpha, LFA-1 beta, LFA-3, beta1-integrin and beta3-integrin was studied on specimens from breast tissue by immunohistochemistry and on cells from breast cell lines propagated in vitro. Breast-cancer tissue and the breast-cancer cell lines MCF-7, SK-BR-3 and ZR-75-1 showed expression of
ICAM-1
and VLA-4 significantly lower than that of benign breast cells or normal breast epithelium. Of various cytokines tested, including recombinant human (rh)
interleukin-6
(
IL-6
), rh tumor necrosis factor alpha (TNF-alpha), interleukin 2 (IL-2), granulocyte/macrophage-colony-stimulating-factor (GM-CSF), interferon-alpha (IFN-alpha) and interferon-gamma (IFN-gamma), only TNF was able to re-induce expression of
ICAM-1
on cells from MCF-7, SK-BR-3 and ZR-75-1. Further, the ability of either unstimulated or lymphokine-stimulated killer (LAK) cells to recognize and lyse native or TNF-stimulated breast-cancer cells was studied. Whereas neither unstimulated lymphocytes or LAK cells were able to lyse untreated breast-cancer cells deficient for
ICAM-1
expression, pre-treatment of tumor cells with TNF led to increased tumor-cell lysis. Anti-
ICAM-1
antibodies, and pre-treatment of tumor cells with anti-TNF-receptor antibodies, abrogated these findings, corroborating their specificity. We thus conclude that the defective expression of
ICAM-1
in our model might constitute a mechanism by which breast-cancer cells escape immunologic recognition and lysis by appropriate effector cells.
...
PMID:Decreased expression of ICAM-1 and its induction by tumor necrosis factor on breast-cancer cells in vitro. 918 15
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>