Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P05231 (interleukin-6)
23,907 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.
...
PMID:[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells]. 899 Sep 29

A patient with Schnitzler's syndrome is described presenting with fever of unknown origin. Although he had all characteristic features of the syndrome (urticarial vasculitis, hyperostosis, lymphadenopathy, fever and serum IgM monoclonal component), it was recognized very late in the diagnostic process. Cytokines were measured to get more insight into the role of cytokines in this syndrome, but only interleukin-6 was elevated. It is important for internists and rheumatologist to recognize this entity in order to prevent unnecessary diagnostic procedures.
...
PMID:Schnitzler's syndrome presenting as fever of unknown origin (FUO). The role of cytokines in its systemic features. 944 24

Continuing our characterization of the immunopathological events occurring during experimental murine Chagas' disease, an immunohistological examination was conducted of the aortas of chronically infected CBA/J mice. Compared with non-infected mice of identical age, Trypanosoma cruzi-infected mice exhibited a marked vasculitis, with significant infiltration of inflammatory cells into the adventitial layer, including CD4+, CD8+ T cells and macrophages. Production of interleukin-6 (IL-6) and tumour necrosis factor-alpha (TNF-alpha) was evident in the inflammatory infiltrate in the endothelial and smooth muscle layers. Vasculitis was most apparent in proximity to the heart, but extended along the aorta. Such an inflammation could lead to an alteration of the endothelium, altering the protective properties of this layer and further contributing to the focal pathology characteristic of this stage of infection.
...
PMID:Cellular and cytokine characterization of vascular inflammation in CBA/J mice chronically infected with Trypanosoma cruzi. 982 55

Vascular involvement in rheumatoid arthritis (RA) is associated with a wide range of extra-articular complications. Damage to internal organs occurs through a widespread disorder of the microvasculature. Vasculitis, as an integral part of the disease process, is associated with immune system abnormalities. To evaluate the relationship between capillaroscopic abnormalities, extra-articular involvement and immunological alterations, serum levels of soluble CD4 (sCD4), CD8 (sCD8), tumour necrosis factor alpha (TNF-alpha), interleukin-6 (IL-6) and soluble interleukin-6 receptor (sIL-6R) were determined by an enzyme-linked immunosorbent assay in 80 RA patients. In all patients with signs of extra-articular manifestations, severe or moderate changes in nailfold capillaroscopy were found. Serum levels of TNF-alpha, IL-6, sIL-6R and sCD4 were significantly higher in RA patients compared with 30 healthy subjects. RA patients with clinical signs of systemic vasculitis showed significantly higher levels of TNF-alpha and IL-6 compared with those without vascular involvement. Moreover, a significant correlation between sCD4 levels and the capillaroscopy findings was found. These results point to a pathogenic role of the cytokine network in rheumatoid vasculitis and further may suggest an important role of cellular immune activation in the pathogenesis of microvascular damage.
...
PMID:Cytokines and soluble CD4 and CD8 molecules in rheumatoid arthritis: relationship to systematic vasculitis and microvascular capillaroscopic abnormalities. 989 Jun 77

The possible use of inflammatory parameters as a predictor of coronary artery lesions (CAL) and the effect of intravenous immunoglobulin (IVIG) treatment in 30 Swedish children with acute Kawasaki disease were investigated. All the patients were treated with IVIG (2 g/kg) and seven of them had CAL. Ten febrile children, hospitalized for treatment of severe infection, and 15 healthy children served as controls. The levels of soluble E-selectin and soluble intercellular adhesion molecule (ICAM)-1 in the Kawasaki patients were elevated in comparison to healthy, but not in comparison to febrile controls. Paired analysis of our patients before and after IVIG therapy during acute disease revealed lowered levels of C-reactive protein, interleukin-6, soluble E-selectin and soluble ICAM-1. We found no statistically significant relationships among any of these parameters as a possible predictor of CAL, but three patients with cardiac sequelae demonstrated high values for these inflammatory parameters. These findings may reflect endothelial activation in connection with vasculitis, and the anti-inflammatory effect of IVIG treatment lowering cytokine levels and subsequently decreasing the expression and shedding of adhesion molecules. In conclusion, we were unable to identify a predictor of CAL in the acute phase. The patients had higher levels of soluble E-selectin and soluble ICAM-1 than did afebrile controls, but not febrile controls. The patients' levels of C-reactive protein, interleukin-6, soluble E-selectin and soluble ICAM-1 were decreased after 1-2d of IVIG treatment.
...
PMID:Inflammatory parameters and soluble cell adhesion molecules in Swedish children with Kawasaki disease: relationship to cardiac lesions and intravenous immunoglobulin treatment. 1050 83

Interleukin-6 (IL6) and suppurating placental inflammation are markers of neonatal sepsis. The purpose of this study was to define a relationship between IL6 and acute chorioamnionitis and funisitis of the placenta, and to compare IL6 levels in term and preterm neonates. Umbilical venous IL6 was measured in 137 term and 110 preterm neonates. Acute chorioamnionitis was graded as none, mild, moderate, severe, and necrotizing. Funisitis was graded as none, 1 vessel, 2 vessels, 3 vessels, or necrotizing. A 2-way analysis of variance with interaction was used to compare the IL6 levels. There was a stepwise progression of IL6 levels with increasing severity of acute chorioamnionitis and funisitis. Term neonates showed an IL6 elevation with mild acute chorioamnionitis and single-vessel vasculitis, which increased progressively until the inflammation became severe. In contrast, IL6 levels in preterm neonates did not increase significantly until severe acute chorioamnionitis or 3-vessel vasculitis was seen. Statistically significant differences in IL6 levels were seen in term versus preterm infants when the acute chorioamnionitis was mild or moderate or when the funisitis involved either 1 or 2 vessels (P < 0.05). The difference may be related to the relative immaturity of the preterm immune system, as has been demonstrated in vivo and in vitro. However, differences in management could be confounding factors. In conclusion, umbilical venous IL6 levels correlate with the severity of acute placental inflammation, with greater IL6 elevations in term infants compared to preterm infants until the inflammation becomes severe.
...
PMID:Umbilical vein interleukin-6 levels correlate with the severity of placental inflammation and gestational age. 1197 75

Idiopathic interstitial pneumonia (IIP) can occur after stem cell transplantation, but the aetiology is unknown. Based on the association between angiitis syndrome and Helicobacter pylori infection, we identified possible risk factors common to these two conditions. Among 83 patients who underwent stem cell transplantation, four developed IIP. We elucidated various parameters and clinical features in four patients with IIP and 79 patients without, after allogeneic stem cell transplantation. In all four patients, (1) the conditioning regimen induced total body irradiation, (2) serological reactivation of cytomegalovirus and/or human herpesvirus-6 preceded the onset of IIP, (3) their human leucocyte antigen types were among those suspected to increase susceptibility to angiitis syndrome, (4) serum anti-H. pylori antibody was positive before conditioning and remained positive throughout the post-transplantation course, (5) inflammatory cytokines (interleukin-6, 8 and 12) were increased during the period of leucocyte recovery after transplantation and (6) the levels of intercellular adhesion molecule-1, thrombomodulin and plasminogen activator inhibitor-1 were increased at the onset of IIP. These findings suggest the possibility that angiitis syndrome and H. pylori infection are involved in the pathogenesis of post-transplantation IIP.
...
PMID:Idiopathic interstitial pneumonia following stem cell transplantation. 1286 90

Giant-cell arteritis is an immune-mediated disease characterized by granulomatous infiltrates in the wall of medium-size and large arteries. The immunopathology consists of 2 components. Excessive cytokine production (for example, of interleukin-1 and interleukin-6) induces systemic inflammation with an exuberant acute-phase response. In parallel, interferon-gamma, which is released by T cells captured in the arterial wall, activates tissue-injurious macrophages. In response to the immune injury, the artery generates hyperplasia of the intima that leads to luminal occlusion and subsequent tissue ischemia. Despite the systemic character of the disease, distinct vascular territories are preferentially affected. On the basis of the predominant involvement, clinical subtypes can be distinguished: cranial giant-cell arteritis with ischemic complications in the eye, the face, and the central nervous system; large-vessel giant-cell arteritis with occlusions in the subclavian or axillary vessels; aortic giant-cell arteritis; giant-cell arteritis presenting as an intense systemic inflammatory syndrome with nonstenosing vasculitis; and "isolated" polymyalgia rheumatica with myalgias, systemic inflammation, and subclinical vasculitis. Temporal artery biopsy remains the diagnostic procedure of choice to detect arteritis in cranial vessels. In other vascular territories, giant-cell arteritis is most commonly diagnosed by vascular imaging. Laboratory studies characteristically document the marked elevations of nonspecific acute-phase reactants, such as C-reactive protein and erythrocyte sedimentation rate. Cytokines, such as interleukin-6, that induce the acute-phase reaction are currently being explored as more sensitive biological markers of disease activity. Corticosteroids are highly effective in suppressing systemic inflammation, but they do not eliminate the immune responses in the vessel wall. In general, the clinical outcome of giant-cell arteritis is excellent, and efforts must now concentrate on tailoring therapies to the needs of the individual patient.
...
PMID:Giant-cell arteritis and polymyalgia rheumatica. 1367 49

We report the clinical and autopsy findings of a 71-year-old Japanese woman with rheumatoid meningitis. This patient developed subacute meningitis during an inactive stage of rheumatoid arthritis (RA), and despite intensive examinations no causative agents or underlying disease could be identified except for RA. Based on persistent hypocomplementaemia and increased serum levels of immune complexes she was suspected of having vasculitis, and was treated with intravenous methylprednisolone (1000 mg/day for 3 days) followed by oral prednisolone. Soon after beginning treatment with corticosteroid her symptoms improved, in parallel with a decrease in cell counts and interleukin-6 in the cerebrospinal fluid. During tapering of oral prednisolone she died of a subarachnoid haemorrhage which was ascribed to a relapse of the meningitis. Autopsy demonstrated infiltration of mononuclear cells, including plasma cells, in the leptomeninges, mainly around small vessels, leading to a definite diagnosis of rheumatoid meningitis. When RA patients manifest intractable meningitis with a subacute course, this disease is important as a possible diagnosis even if the arthritis is inactive, and intensive treatment, including corticosteroid and immunosuppressants, should be positively considered as a therapeutic option as soon as possible because of the poor prognosis.
...
PMID:Rheumatoid meningitis: an autopsy report and review of the literature. 1467 33

Plasma concentrations of 8 proteins, including cytokines: interleukin-2 (IL-2), interleukin-6 (IL-6), interleukin-10 (IL-10), tumor necrosis factor-alpha (TNF-alpha), receptors: soluble IL-2 receptor (slL-2R), p55 soluble TNF receptor (p55 sTNF-R) and acute phase proteins: alpha-2 macroglobulin (alpha-2 MG), C-reactive protein (CRP) were examined in 14 patients with drug-induced hyperergic vasculitis. The activity of selected proteins were measured using the immunoenzymatic ELISA method: a) in the acute stage of disease before treatment was administered, and b) after clearing of skin lesions, after treatment. In the acute stage of disease highly elevated concentrations of the examined proteins (p<0.001) in comparison to the control were found. After clearing of clinical symptoms the concentrations of IL-6 and alpha-2 MG were not significantly different from the control values. But despite deep decrease, plasma levels of remaining six proteins were still highly significant (p<0.001) or significant (p<0.01) when compared to the control. Results of this study indicate that in the course of drug-induced hyperergic vasculitis the systemic inflammatory and immune response is activated and elevated concentrations of the examined proteins are present in peripheral blood despite clearing of the clinical symptoms of the disease.
...
PMID:Drug-induced hyperergic vasculitis--activity of selected cytokines and acute phase proteins in plasma. 1531 57


<< Previous 1 2 3 4 5 6 7 8 9 Next >>