Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P05109 (S100A8)
1,212 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
...
PMID:Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. 229 70

The minichromosome maintenance (MCM) 2-7 helicase complex functions to initiate and elongate replication forks. Cell cycle checkpoint signaling pathways regulate DNA replication to maintain genomic stability. We describe four lines of evidence that ATM/ATR-dependent (ataxia-telangiectasia-mutated/ATM- and Rad3-related) checkpoint pathways are directly linked to three members of the MCM complex. First, ATM phosphorylates MCM3 on S535 in response to ionizing radiation. Second, ATR phosphorylates MCM2 on S108 in response to multiple forms of DNA damage and stalling of replication forks. Third, ATR-interacting protein (ATRIP)-ATR interacts with MCM7. Fourth, reducing the amount of MCM7 in cells disrupts checkpoint signaling and causes an intra-S-phase checkpoint defect. Thus, the MCM complex is a platform for multiple DNA damage-dependent regulatory signals that control DNA replication.
...
PMID:Minichromosome maintenance proteins are direct targets of the ATM and ATR checkpoint kinases. 1526 78