Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P05109 (
S100A8
)
1,212
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Forty-one endomyocardial biopsies of the right interventricular septum have been investigated in 24 immunosuppressed patients after orthotopic heart transplantation. Monoclonal antibodies 27E10, 25F9, and RM3/1, which react with different macrophage phenotypes, and antisera
MRP-8
and MRP-14, specific for proteins expressed on endothelial and monocyte cell surfaces in inflammation as well as markers for CD4+ and CD8+ T-lymphocytes, were employed in an indirect immunoperoxidase staining technique. This methodology permits more physiological recognition of the inflammatory process within the myocardium. It was possible to verify and to distinguish acute early, late and down-regulatory stages of inflammation in 33 biopsies (80%). No evidence of inflammation was found in seven biopsies (17%). Conventional histopathology with haematoxylin-eosin and Masson's trichrome was performed simultaneously, and demonstrated inflammation to be present in 23 of 41 biopsies (56%). An important findings is that CD4+ and CD8+ lymphocytes were absent in 15 of 41 specimens (37%) although there was inflammation proven by the presence of different macrophage phenotypes. The results indicate the necessity of long-term serial investigations of the physiological role of specific inflammatory macrophage phenotypes during the rejection process. It is concluded that the phenotyping of macrophage and endothelial cell differentiation antigens offers a sensitive approach to assess diagnosis of myocardial inflammation as a consequence of ongoing rejection in cardiac allografts.
...
PMID:Diagnostic assessment of macrophage phenotypes in cardiac transplant biopsies. 191 56
Analysis of the protein patterns of normal and psoriatic noncultured unfractionated keratinocytes has revealed several low-molecular-weight proteins that are highly up-regulated in psoriatic epidermis. Here, we have cloned and sequenced the cDNA (clone 1085) for one of these proteins that we have termed psoriasin. The deduced sequence predicted a protein of molecular weight of 11,457 daltons and a pI of 6.77. The protein co-migrated with psoriasin as determined by two-dimensional (2D) gel analysis of [35S]-methionine-labeled proteins expressed by RK13 cells transfected with clone 1085 using the vaccinia virus expression system. Analysis of the predicted sequence revealed a potential calcium-binding sequence of the EF-hand type, as well as the absence of a signal sequence at its amino terminal. Psoriasin is not related to other proteins that migrate closely in 2D gels (MRP 14, also known as calgranulin B, L1 and calprotectin; MRP 8, or
calgranulin A
and cystatin A or stefin A), and bears no significant sequence homology with any other protein of known primary structure. Increased expression of psoriasin mRNA in psoriatic keratinocytes was confirmed by Northern blotting and in situ hybridization. Psoriasin showed a restricted occurrence in fetal human tissues as determined by 2D gel electrophoresis. Of 21 tissues analyzed, only ear, skin, and tongue showed significant levels of this protein. Psoriasin was not detected in normal human fibroblasts, lymphocytes, endothelial cells and transformed epithelial cells of keratinocyte origin. Granulocyte extracts contained this protein suggesting that its overexpression by psoriatic keratinocytes may be linked to the inflammatory stimuli.
...
PMID:Molecular cloning, occurrence, and expression of a novel partially secreted protein "psoriasin" that is highly up-regulated in psoriatic skin. 194 Apr 42
Cystic fibrosis protein is a serum protein characterized by a pI close to 8.4 and present with a higher concentration in serum and plasma of cystic fibrosis carriers than in controls. This protein was found immunologically indistinguishable from the cystic fibrosis antigen isolated from granulocytes and presenting a sequence analogous to that of
MRP-8
, a calcium-binding protein expressed in the myeloid cell lineage. Using antibodies directed against
MRP-8
and its closely associated calcium-binding protein, MRP-14, we demonstrate here that cystic fibrosis protein purified from serum is a complex of the two proteins
MRP-8
and MRP-14.
...
PMID:Identification of 'cystic fibrosis protein' as a complex of two calcium-binding proteins present in human cells of myeloid origin. 200 32
A calcium-binding protein was isolated from serum-free culture medium of human squamous carcinoma cells (HS 24). N-Terminal sequencing of the protein yielded 30 amino acids which were identical to the N-terminus of cystic fibrosis antigen. Northern blot analysis with an oligonucleotide derived from the N-terminus resulted in the detection of a transcript of approximately 600 bases. Screening of a HS 24-cDNA library with the same oligonucleotide led to the isolation of a 381-bp-cDNA encoding a protein of 93 amino acids. The corresponding protein has been identified as the
calcium-binding protein MRP-8
usually found in Macrophages.
...
PMID:The calcium-binding protein MRP-8 is produced by human pulmonary tumor cells. 203 99
MRP-8
and MRP-14 are calcium-binding proteins belonging to the S-100 protein family which have been shown to be associated with specific stages of myeloic/monocytic cell differentiation. Members of this protein family are shown to form homo- and heterodimers. Complex formation has also been observed in preliminary experiments for
MRP-8
and MRP-14. To evaluate the in vivo relevance of the MRP complex formation and the stoichiometric ratio of individual components complexes were isolated from granulocytes and monocytes by immunoaffinity chromatography using monospecific antibodies. The purified fraction of the MRPs was found to contain monomers and dimers as shown on sodium dodecyl sulfate-polyacrylamide gel electrophoresis by silver staining and immunoblotting. Similar results were obtained by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting of crude cell extracts. The existence of the MRP complexes in vivo was demonstrated by chemical cross-linking and subsequent isolation of complexes by immunoaffinity chromatography. Two new, highly abundant complexes were found in addition to the heterodimer, but neither monomers nor homodimers were detected. The two larger protein complexes (35.0 and 48.5 kDa) were identified as [
MRP-8
)2.(MRP-14] trimer and [
MRP-8
)2.(MRP-14)2) tetramer, respectively. All complexes could be shown to be noncovalently associated in vivo. Furthermore, the association of MRPs was shown to be Ca2+ dependent.
...
PMID:Calcium-dependent complex assembly of the myeloic differentiation proteins MRP-8 and MRP-14. 207 12
The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(
CAGA
)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.
...
PMID:Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures. 225 31
The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (
CAGA
)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
...
PMID:Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. 229 70
The molecules
calgranulin A
and B are two intracellular calcium-binding proteins which are expressed by the lesional keratinocytes of inflammatory dermatoses. We have investigated the induction of the calgranulin proteins in an in vitro system and characterized the epidermal form of calgranulin. Using calgranulin-specific monoclonal antibodies, we have shown that these proteins are expressed within the epidermis of skin explants after 12-24 h culture in vitro. The induction of calgranulin-specific staining on culture was prevented, however, by the inclusion of cycloheximide in the culture medium, in sufficient quantities to prevent de novo protein synthesis. Indirect immunofluorescence staining was used to analyse the subcellular localization of the calgranulin proteins. The specific staining pattern with antibodies which recognize the individual calgranulin proteins was retained in detergent insoluble cytoskeletal preparations of epidermis. In Western blotting experiments epidermal calgranulins could be solubilized only by using a urea-based protein extraction buffer. After sodium dodecyl sulphate (SDS) polyacrylamide gel electrophoresis of the epidermal extracts a single antigen, with a molecular weight of 13.0 kD was detected with the calgranulin-specific antibody MAC 387. The expression of calgranulins, similar to other members of the same protein family, may regulate cytoskeletal changes in skin disease.
...
PMID:Calgranulin expression and association with the keratinocyte cytoskeleton. 231 77
Three cDNA clones coding for the 3' region of the intracisternal A-particle (IAP), a mouse endogenous retrovirus, were isolated during screening of a library for genes whose expression was modulated during the retinoic acid-induced differentiation of the embryonal carcinoma cell line F9 into parietal endoderm-like (PE-like) cells. In contrast to previously reported results, no IAP transcripts were detected in either F9 cells or two pluripotent cell lines tested. Instead, IAP transcripts as well as IAPs were abundant in the PE-like cells PYS-2 and F9AcCl 9 and in retinoic acid-induced F9 cells but not in the other differentiated cell types of teratocarcinoma origin which were examined. A comparison of the nucleotide sequences of the three IAP cDNA clones with a genomically integrated proviral sequence (MIA14) demonstrated heterogeneity in both length and sequence among the clones. The position of the poly(A) addition site was determined to be 15 nucleotides from the proposed poly(A) addition signal and to occur after the sequence
CAGA
, not CA, as previously proposed. Length heterogeneity was greatest in a region of TC repeats 80 base pairs 5' to the poly(A) addition site. Additionally, the putative TATAA box found in MIA14 was deleted in the cDNA clones and in the long terminal repeat regions from two other genomic clones examined. The heterogeneity evident among the cDNA clones further demonstrated that at least two distinct IAP genes are activated during differentiation. An analysis of the rate of transcription in isolated nuclei indicated that the activation of expression of IAP genes in PE-like cells is the result of transcriptional regulation. Together, these observations suggest that the modulation of IAP transcription is regulated autonomously rather than by the fortuitous integration of an IAP sequence adjacent to a developmentally regulated cellular gene.
...
PMID:Expression of the intracisternal A-particle is elevated during differentiation of embryonal carcinoma cells. 243 Dec 66
The Faza 967 'differentiated', dexamethasone (DEX)-sensitive cell line of Reuber rat hepatoma cells does not synthesize detectable amounts of alpha-fetoprotein (AFP), whereas it does produce albumin. AFP production was activated in 'differentiated' variants of Faza 967 cells with reduced glucocorticoid sensitivity upon culture for several months in the presence of high concentrations of dexamethasone. The stability of AFP production differed among the variants, while albumin synthesis did not change, thus indicating that the regulation of these two genes is not co-ordinated. Using molecular hybridization techniques, we found that the AFP message could not be detected in the non-AFP-producing cells, suggesting that the lack of AFP synthesis most probably originates from a transcriptional block of the AFP gene. AFP-producing and non-AFP-producing variants of Faza 967 cells constitute a valuable model system for studying the regulatory mechanisms involved in the activation and inactivation of the gene coding for the
oncodevelopmental protein
, AFP.
...
PMID:Activation of alpha-fetoprotein synthesis in rat hepatoma cells with reduced sensitivity to dexamethasone. 243 44
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>