Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P05109 (S100A8)
1,212 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The expression of the heterodimeric complex of the calcium-binding proteins MRP-8 and MRP-14 was investigated in various inflammatory dermatoses using immunohistochemical staining with the monoclonal antibody 27E10. In addition to the inflammatory infiltrate, a positive staining was repeatedly found in the involved epidermis from patients with lichen planus, lupus erythematosus and psoriasis vulgaris, but not in normal skin epidermis and/or in epidermis from leucocytoclastic vasculitis patients. The keratinocytic expression of the 27E10 antigen was dissimilar to that of the MHC class-II molecules and the adhesion molecule ICAM-1. These data indicate that the 27E10 antigen is a distinct activation marker of inflammatory keratinocytes and may have proinflammatory properties.
...
PMID:Epidermal expression of the calcium binding surface antigen 27E10 in inflammatory skin diseases. 128 18

To further understand the mechanisms involved in phagocyte activation in general and in NADPH oxidase activation in particular, a polyclonal antibody was raised in rabbit against a partially purified oxidase preparation. The enzyme was solubilized from zymosan-activated human neutrophils and resting cells and separated by preparative isoelectric focusing electrophoresis. A polyclonal antibody was raised in rabbit against the pI 5.0 fraction, which had the maximum superoxide-producing capacity. Analysis of the polyclonal antibody revealed marked differences between activated and resting neutrophils. The antibody recognized in particular an 8-kDa protein (p8) in resting human neutrophil cytosol and in the membrane of zymosan-activated cells. A polyclonal antibody (anti-p8) was raised against the pure cytosolic p8 protein. This anti-p8 reacted not only with p8, but also with cytosolic proteins of 14 kDa and 6 kDa. N-terminal amino acid sequence analysis of p8 revealed homology with the calcium-binding myeloid related protein (MRP-8). Upon neutrophil activation, translocation of the 8- and 14-kDa proteins to the membrane was observed with stimuli known to depend on extracellular calcium. In calcium-depleted medium, the absence of translocation correlated with a depression of superoxide production, supporting a role for the calcium-binding protein in cellular activation.
...
PMID:Translocation of a small cytosolic calcium-binding protein (MRP-8) to plasma membrane correlates with human neutrophil activation. 132 51

The monoclonal antibody F12, raised against epidermal cells from a psoriatic lesion, decorated antigens highly expressed in psoriatic epidermis and in cultured normal human keratinocytes. In normal human skin, F12 reacted only with follicular keratinocytes. Characterization of the immunoprecipitated antigens by two-dimensional gel electrophoresis revealed their identity with calgranulin A and B. A semiquantitative study with various established epithelial cell lines demonstrated that the expression of calgranulin A and B in hyperproliferative keratinocytes correlates with their potential to undergo terminal differentiation. In epidermis reconstructed in vitro, the antigen expression was stimulated by retinoids and suppressed under vitamin A starvation.
...
PMID:Differential expression of calgranulin A and B in various epithelial cell lines and reconstructed epidermis. 143 Dec 28

Two calcium binding proteins, MRP-8 and MRP-14, are specifically synthesized in human myeloid cells. This paper shows that Me2SO, all-trans-retinoic acid (RA) and 1 alpha,25-dihydroxyvitamin D3 (1 alpha,25(OH)2D3), but not 12-O-tetradecanoyl phorbol-13-acetate (PMA) are potent inducers of MRP-8/14 protein complex in human leukemic cells. Transforming growth factor-beta 1 (TGF-beta 1) is shown to enhance the inductive effect of RA and 1 alpha,25(OH)2D3. We have examined the possibility that MRP expression is regulated through the protein kinase pathway. Both cytosolic and membrane-bound protein kinase C (PKC) activities increased during differentiation by RA and 1 alpha,25(OH)2D3. PMA-treatment led to a decrease of cytosolic PKC activity and an increase of membrane-bound PKC activity in the presence of these differentiation inducers, while PMA alone resulted in low cytosolic and high membrane-bound PKC activities. PKC inhibitor H7 inhibited MRP synthesis in HL-60 cells treated with RA and 1 alpha,25(OH)2D3. These results suggest that cytosolic PKC activity may be involved in a stimulatory pathway of MRP synthesis and that protein phosphorylation reactions may play important roles in MRP expression during myelocytic differentiation.
...
PMID:Regulation of myeloid-specific calcium binding protein synthesis by cytosolic protein kinase C. 147 21

Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes.
...
PMID:Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes. 151 Nov 35

Analysis by means of two-dimensional (2D) gel electrophoresis of the protein patterns of normal and psoriatic unfractionated non-cultured keratinocytes has revealed a few low-molecular-weight proteins that are highly up-regulated in psoriatic skin. These include psoriasin; calgranulin B, also known as MRP 14, L1, or calprotectin; calgranulin A or MRP 8; and cystatin A or stefin A. Here, we have cloned and sequenced the cDNA (clone 1592) encoding a new member of this group of low-molecular-weight proteins [isoelectric focusing (IEF) SSP 3007 in the keratinocyte 2D gel protein database] that we have termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA-FABP as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino acid sequence revealed 48%, 52%, and 56% identity to known low-molecular-weight fatty acid-binding proteins belonging to the FABP family. Northern blot analysis showed that PA-FABP mRNA is indeed highly up-regulated in psoriatic keratinocytes. The transcript is present in human cell lines of epithelial and lymphoid (Molt 4) origin but cannot be detected in normal or SV40 transformed MRC-5 fibroblasts. 2D gel protein analysis of normal primary keratinocytes cultured for at least 8 d under conditions that promoted incomplete terminal differentiation [serum-free keratinocyte (SFK) medium supplemented with epidermal growth factor (EGF), pituitary extract, and 10% fetal calf serum] revealed a strong up-regulation of PA-FABP, psoriasin, calgranulins A and B, and a few other proteins that are highly expressed in psoriatic skin. The levels of these proteins exceeded by far those observed in non-cultured normal keratinocytes implying that the cultured cells have followed an altered pattern of differentiation that resembles--at least in part--that of non-cultured psoriatic keratinocytes. The implications of these results for the study of psoriasis are discussed.
...
PMID:Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins. 151 66

In delayed-type hypersensitivity reactions, cytokine-mediated cell migration leads to localized accumulation of neutrophils and mononuclear cells over 4-48 h. In contrast to transient (2-6 h) responses elicited by other chemotactic factors, earlier studies indicated that a chemotactic activity previously described in our laboratory elicited skin test responses over 24 h, identical to those induced by injection of antigen into a sensitized test subject. We have isolated this factor, a 10.3-kDa chemotactic protein designated CP-10, from supernatants of activated murine spleen cells. Purification to homogeneity was achieved using affinity chromatography on iminodiacetic acid-immobilized copper and cation-exchange, mixed mode (cation exchange/metal affinity), reversed-phase, and size-exclusion high performance liquid chromatography. CP-10 had maximal chemotactic activity for neutrophils at 10(-13) M. The 76-amino acid sequence, obtained by automated N-terminal microsequence analysis of native CP-10, and fragments derived from trypsin digestion and cyanogen bromide cleavage indicated no sequence identity with any known cytokine or chemotactic factor but revealed up to 55% sequence homology with S100, Ca2(+)-binding proteins. CP-10 appears to be the first protein of this family with a well defined function affecting cell migration, and its biological potency suggests an important role for this cytokine in cellular immune reactions.
...
PMID:Purification and structural analysis of a murine chemotactic cytokine (CP-10) with sequence homology to S100 proteins. 155 87

Two closely related Ca(2+)-binding proteins, migration inhibitory factor-related protein (MRP)-8 and MRP-14, are synthesized under specific conditions of myeloid cell differentiation. Because 1 alpha,25-dihydroxyvitamin D3 [1,25-(OH)2D3] induces myeloid cell differentiation and expression of other S-100 class calcium-binding proteins, we examined the effects of 1,25-(OH)2D3 on MRP mRNA levels in human U-937 histiocytic lymphoma cells. 1,25-(OH)2D3 increased MRP-8 and MRP-14 mRNA levels in a time- and dose-dependent manner. MRP mRNA levels were maximal at 24 h and remained elevated for at least 96 h after exposure of the cells to 1,25-(OH)2D3. MRP-8 mRNA accumulation required 100- to 1,000-fold higher concentrations of 25-(OH)D3, which binds to the 1,25-(OH)2D3 intracellular receptor with 100- to 1,000-fold lower affinity. Other differentiating agents, dimethyl sulfoxide, retinoic acid, and dexamethasone, also increased levels of MRP-8 and MRP-14 mRNA. Phorbol myristate acetate enhanced MRP-14 mRNA levels to a greater extent than MRP-8 mRNA levels, suggesting differential regulation of MRP gene expression by protein kinase C. The 1,25-(OH)2D3-induced relative increase in MRP mRNA levels was not changed by a 1,000-fold reduction in extracellular [Ca2+]. Thus 1,25-(OH)2D3 is potentially a physiological modulator of MRP gene expression. Expression of the MRP-8 and MRP-14 genes may be important for differentiation of myeloid cells.
...
PMID:1 alpha,25-(OH)2 vitamin D3 enhances expression of the genes encoding Ca(2+)-binding proteins MRP-8 and MRP-14. 173 33

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.
...
PMID:Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells. 184 41

Oncomodulin is a 108-residue, oncodevelopmental protein containing two calcium-binding sites identified as the CD- and EF-loops. The protein contains no tryptophan and only two tyrosine residues, one which is a calcium ligand in the CD-loop (Tyr-57) and one which lies in the flanking D-helix of this loop (Tyr-65). Site-specific mutagenesis was performed to yield five mutants, two with phenylalanine substituted for tyrosine in positions 57 and 65 and three with tryptophan substituted into position 57 in the CD-loop, position 65 in the D-helix, and position 96 in the EF-loop. The single Tyr-containing mutants demonstrated that position 57 was perturbed to a significantly greater extent than position 65 upon calcium binding. Although both tyrosine residues responded to decalcification, the fluorescence intensity changes were in opposite directions, with the more dominant Tyr-57 accounting for the majority of the intrinsic fluorescence observed in native oncomodulin. The substitution of tryptophan for each tyrosyl residue revealed that in both positions the tryptophan resided in polar, conformationally heterogeneous environments. The environment of Trp-57 was affected by Ca2+ binding to a much greater extent compared to that of Trp-65. Only 1 equiv of Ca2+ was required to produce greater than 70% of the Trp fluorescence changes in positions 57 and 65, indicating that Ca2+ binding to the higher affinity EF-loop had a pronounced effect on the protein structure.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Metal-induced changes in the fluorescence properties of tyrosine and tryptophan site-specific mutants of oncomodulin. 185 60


1 2 3 4 5 6 7 8 9 10 Next >>