Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P05109 (S100A8)
 1,212 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
 ...
PMID:Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. 229 70

The neutrophil cytoplasmic protein S100A8/A9 (along with S100A8 and S100A9) is chemotactic and stimulates neutrophil adhesion by activating the beta2-integrin CD11b/CD18. It is also essential to neutrophil migration in vivo in response to monosodium urate monohydrate (MSUM) crystals, the principal etiologic agent of gout. S100A8/A9 is present in the synovial fluid of patients with gout and arthritis and is secreted by activated monocytes; however, its mechanism of release by neutrophils remains unknown. The aim of this study was to identify the mechanism of stimulation of the release of S100A8/A9 by MSUM-activated neutrophils. Here, we show that S100A8/A9 is released by neutrophils stimulated with MSUM crystals and that this release could be enhanced by preincubating neutrophils with granulocyte macrophage-colony stimulating factor. Antibodies directed against CD11b and CD16 blocked the release induced by MSUM crystals, suggesting that Fc receptor for immunoglobulin G (FcgammaR)IIIB (CD16) and CD11b/CD18 were involved in the stimulation by MSUM crystals. Neutrophil preincubation with the Src kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl) pyrazolo[3,4-d]pyrimidine and the Syk tyrosine kinase inhibitor trans-3,3',4,5'-tetrahydrozystilbene significantly reduced the release of S100A8/A9, suggesting that the Src tyrosine kinase family and Syk were involved. In addition, wortmannin reduced neutrophil release of S100A8/A9, indicating a potential involvement of phosphatidylinolitol-3 kinase in this release. Preincubation of neutrophils with the tubulin depolymerization promoters nocodazole and vincristine reduced MSUM-induced release, suggesting a tubulin-associated pathway of release. These results indicate that S100A8/A9 is released by MSUM crystal-stimulated neutrophils following activation of CD11b, CD16, Src kinases, Syk, and tubulin polymerization.
 ...
PMID:Monosodium urate monohydrate crystals induce the release of the proinflammatory protein S100A8/A9 from neutrophils. 1510 58

Although B-cell acute lymphoblastic leukemia (B-ALL) is the most common malignancy in children and while highly curable, it remains a leading cause of cancer-related mortality. The outgrowth of tumor subclones carrying mutations in genes responsible for resistance to therapy has led to a Darwinian model of clonal selection. Previous work has indicated that alterations in the epigenome might contribute to clonal selection, yet the extent to which the chromatin state is altered under the selective pressures of therapy is unknown. To address this, we performed chromatin immunoprecipitation, gene expression analysis, and enhanced reduced representation bisulfite sequencing on a cohort of paired diagnosis and relapse samples from individual patients who all but one relapsed within 36 months of initial diagnosis. The chromatin state at diagnosis varied widely among patients, while the majority of peaks remained stable between diagnosis and relapse. Yet a significant fraction was either lost or newly gained, with some patients showing few differences and others showing massive changes of the epigenetic state. Evolution of the epigenome was associated with pathways previously linked to therapy resistance as well as novel candidate pathways through alterations in pyrimidine biosynthesis and downregulation of polycomb repressive complex 2 targets. Three novel, relapse-specific superenhancers were shared by a majority of patients including one associated with S100A8, the top upregulated gene seen at relapse in childhood B-ALL. Overall, our results support a role of the epigenome in clonal evolution and uncover new candidate pathways associated with relapse. SIGNIFICANCE: This study suggests a major role for epigenetic mechanisms in driving clonal evolution in B-ALL and identifies novel pathways associated with drug resistance.
 ...
PMID:Evolution of the Epigenetic Landscape in Childhood B Acute Lymphoblastic Leukemia and Its Role in Drug Resistance. 3306 68