Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P05109 (
S100A8
)
1,212
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(
CAGA
)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the
DHFR
replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.
...
PMID:Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures. 225 31
A simple and effective system has been developed from which a number of Plasmodium falciparum dihydrofolate reductase (pfDHFR) mutants conferring resistance to antifolates were randomly generated and characterized. The system exploited error-prone PCR to generate random mutations in the pfDHFR. Using the synthetic gene encoding for wild-type and quadruple mutant (N51I+C59R+S108N+I164L) pfDHFRs as templates, mutants resistant to pyrimethamine (Pyr), m-Cl analogue of Pyr (SO3) and WR99210 were selected by bacterial complementation system in which the endogenous
DHFR
activity of bacterial host cells, but not of Plasmodium, is selectively inhibited by trimethoprim (Tmp). Mutants conferring resistance to antimalarial antifolates were selected under the condition that inhibited the growth of the wild-type pfDHFR. All obtained Pyr resistant mutants possessed
S108
mutation, in combination with common mutations of N51I, C59R and I164L previously found in the field. New Pyr resistant mutants with novel mutations (K27T, N121D, N144K and V213E) not found in the field were also identified. Exposure of the randomly mutated pfDHFR libraries to WR99210 or SO3 resulted in selection of novel single and multiple mutants including D54N, F58L and a combination of C50R, K181R, T219P and K227E, which exhibited 2- to over 2000-fold increase in resistance against antifolates. Kinetic analysis of these mutants suggested that apart from the active site residues that are crucial for
DHFR
activity, residues remote from the binding pocket also play essential roles in substrate and inhibitor binding.
...
PMID:Novel antifolate resistant mutations of Plasmodium falciparum dihydrofolate reductase selected in Escherichia coli. 1184 6