Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
 77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Mutation of the p53 gene is one of the most frequent genetic changes found in human cancers. Recent experiments indicated that p53 might contain a transcription-activating domain, which functions when directed to a promoter. This study shows that wild-type p53 suppresses transcription of the retinoblastoma (Rb) gene. From deletion and mutagenesis experiments, a cis-acting element (GGAAGTGA) susceptible to regulation by p53 was mapped within the Rb promoter. This element overlaps the basal transcription unit of the Rb promoter, suggesting that p53 suppresses Rb transcription through inhibition of the basal promoter activity. The N-terminal acidic and C-terminal basic domains of p53 were both required for this suppression. These findings indicate that p53 can act as a transcriptional regulator in vivo.
 ...
PMID:Negative regulation of Rb expression by the p53 gene product. 160 30

Mutation of the retinoblastoma (Rb) gene is found frequently in human sarcomas, lung, bladder and breast carcinomas and is the molecular basis for hereditary predisposition to retinoblastoma. The Rb protein is a nuclear phosphoprotein that is differentially phosphorylated during the cell cycle. Its precise function is unknown but it has been suggested that it may act as a transcriptional regulator or as a regulator of cellular DNA synthesis. The Rb protein forms specific complexes with the oncogenes of three different groups of DNA tumour viruses. We have prepared a new monoclonal antibody to the Rb protein and used it to establish sensitive immunoassays for Rb complexed to T antigen. In SV40-infected and transformed cells these assays showed that Rb enters a trimolecular complex containing p53, Rb and T. A large panel of human tumour cell lines was tested for expression, cellular localization and T-binding activity of Rb using the new antibody.
 ...
PMID:Cellular localization and T antigen binding of the retinoblastoma protein. 174 Nov 57

Wild-type (w.t.) p53 acts as a transcriptional regulator that binds to DNA and modulates transcription of several promoters. Wild-type p53 has also been shown to autoregulate its own transcription. There is no agreement, however, on whether w.t. p53 has trans-activates or downregulates its own transcription. To further explore the transcriptional autoregulation of the p53 gene, we analyzed the effect of w.t. p53 on its own promoter in different cell lines that do not express p53. A DNA domain within the human p53 promoter (-48 to -23) with the structure of ATGGGATTGGGGTTTTCCCCTCCCAT shares 8 of 10 nucleotides sequence homology with the p53 binding motif. When the human p53 promoter that included this domain was linked to a chloramphenicol acetyltransferase (CAT) gene and coexpressed with w.t. or mutated p53 in cells lacking p53 protein, w.t. p53 down-regulated its own promoter in SAOS-2 and K562 cells, but not in DP15 cells. We were unable to detect direct interaction of p53 with its promoter or to domain -48 to -23 following transfection of these cells with w.t. p53. A different pattern of protein--DNA complexes was observed, however, between the p53 promoter and nuclear extracts from SAOS-2 and DP15 cells following transfection with w.t. p53. These data suggest that w.t. p53 autoregulates its own promoter indirectly and in a cell type-specific manner.
 ...
PMID:Wild-type p53 regulates its own transcription in a cell-type specific manner. 766 53

The tumor suppressor protein p53 is a transcriptional regulator that enhances the expression of proteins that control cellular proliferation. The multisubunit transcription factor IID (TFIID) is thought to be a primary target for site-specific activators of transcription. Here, a direct interaction between the activation domain of p53 and two subunits of the TFIID complex, TAFII40 and TAFII60, is reported. A double point mutation in the activation domain of p53 impaired the ability of this domain to activate transcription and, simultaneously, its ability to interact with both TAFII40 and TAFII60. Furthermore, a partial TFIID complex containing Drosophila TATA binding protein (dTBP), human TAFII250, dTAFII60, and dTAFII40 supported activation by a Gal4-p53 fusion protein in vitro, whereas TBP or a subcomplex lacking TAFII40 and TAFII60 did not. Together, these results suggest that TAFII40 and TAFII60 are important targets for transmitting activation signals between p53 and the initiation complex.
 ...
PMID:p53 transcriptional activation mediated by coactivators TAFII40 and TAFII60. 780 97

The p53 encodes a cellular phosphoprotein that has been association with both neoplastic transformation and the control of cellular growth. Recent studies have reported that p53 also acts as a transcriptional regulator. We have studied transactivational properties of human wild-type and mutant p53 proteins representing 4 major mutational hotspots (codons 141, 175, 248, 273) as well as a double mutant Tyr141/His273 and a p53 with the transcriptional activating region removed (pcDC2). Transactivation by p53 was shown with a p53 concensus binding sequence controlled CAT reporter gene, and activity was assayed after co-transfection of the reporter with either wild-type or mutant p53 expression constructs. Wild-type p53 as well as one mutant p53 [(mutation of arginine to histidine at codon 273 (His 273)], had strong transactivating activity, but all other mutant p53s were inactive in transcriptional activation, including the double mutant Tyr141/His273 suggesting that the Tyr141 mutation was dominant over the His273 mutation in the same protein. Moreover, when mutant p53 (Tyr141, His175, Trp248, or Tyr141/His273) was cotransfected with either wild-type p53 or mutant His273 p53, these mutants inhibited the transactivation of coexpressed wild-type p53. The p53 vector (pcDC2), which contains p53 oligomerization sequences, but not the transactivational domain, markedly inhibited wild-type p53 transactivational activity. Each of the mutant p53s similarly inhibited the transactivation of His273 p53. Therefore, with the exception of His273, each of the other mutant p53 were unable to transactivate and each behaved in a dominant negative fashion.
 ...
PMID:Mutant p53 proteins behave in a dominant, negative fashion in vivo. 784 18

Skeletal muscle differentiation entails the coordination of muscle-specific gene expression and terminal withdrawal from the cell cycle. This cell cycle arrest in the G0 phase requires the retinoblastoma tumor suppressor protein (Rb). The function of Rb is negatively regulated by cyclin-dependent kinases (Cdks), which are controlled by Cdk inhibitors. Expression of MyoD, a skeletal muscle-specific transcriptional regulator, activated the expression of the Cdk inhibitor p21 during differentiation of murine myocytes and in nonmyogenic cells. MyoD-mediated induction of p21 did not require the tumor suppressor protein p53 and correlated with cell cycle withdrawal. Thus, MyoD may induce terminal cell cycle arrest during skeletal muscle differentiation by increasing the expression of p21.
 ...
PMID:Correlation of terminal cell cycle arrest of skeletal muscle with induction of p21 by MyoD. 786 39

Recent evidence suggests that the tumor-suppressor protein p53 functions as a transcriptional regulator to control cell proliferation. An interaction with p53 is required for SV40 T antigen to transform primary cells; however, the effect of T antigen binding on p53 function is not known. In order to determine if an interaction with T antigen results in loss of p53-mediated transcriptional activity, we have used vectors expressing either a p53-GAL4 fusion protein or a wild-type p53 protein in transient co-transfection assays with T-antigen expression vectors. We have demonstrated that coexpression of T antigen significantly reduces both p53-GAL4-mediated transcription from a GAL4-dependent CAT reporter and p53-mediated transcription from a consensus p53 binding site in vivo. Moreover, T antigen was able to reduce binding of p53-GAL4 to its GAL4 binding sequence in gel shift experiments in vitro. These observed activities of T antigen were all dependent upon a functional p53-binding domain. In addition, coexpression of human papillomavirus type 18 E6 protein, able to bind to p53, was able to significantly reduce p53-mediated transcription. These results suggest that an interaction of certain viral oncoproteins with p53 results in loss of transcriptional activity of p53, a function that is important for maintaining normal cell growth.
 ...
PMID:SV40 T antigen abrogates p53-mediated transcriptional activity. 837 89

Alterations or elimination of the p53 protein is frequently occurring during human carcinogenesis. Overexpression of wild-type p53 has a profound growth-inhibitory effect on many cell lines, including strong and apparently non-sequence specific repression of a number of promoters. Consistent with the hypothesis that it acts as transcriptional regulator, wild-type p53 protein binds DNA and activates transcription of several promoters. We have studied DNA binding and transactivation (TA) properties of human wild-type and mutant p53 proteins representing four major mutational hotspots. DNA-gel retardation was used to detect specific p53-DNA complexes in nuclear extracts, with radiolabelled oligonucleotides representing high affinity p53-binding sites (HBS) as a probe. p53-specific complexes were identified by competition with unlabelled 'self' oligos and by double band-shifts in the presence of anti-p53 antibodies. To show transactivation by p53, TK promoter-driven CAT reporter gene was placed 3' of the p53-binding site. CAT activity was assayed after co-transfection of reporters with either wild-type (WT) or mutant p53 expression constructs into human cells that do not express p53 (SKOV3). We found that wild-type p53 has strong transactivating effect on the reporter. All mutants, with the exception of His273, were inactive in TA-assay. p53 is a target of several oncogenes found in DNA tumor viruses. We examined the effect of either SV40 T-ag or 55 kDa EIB protein of Ad5 on DNA binding and transactivation by p53 in transformed COS-1 and 293 cell lines, respectively. COS-1 extracts produced strong p53-dependent band-shift of the HBS oligos, that was doubleshifted by anti-p53 but not anti-T-ag antibodies, indicating that T-ag is not part of the complex. COS-1 cells had a high level of WT p53-dependent expression of transfected CAT reporter, indicating the presence of transactivation-competent p53, acting through the HBS element. In human Ad-transformed 293 cells, endogenous p53 was also transactivation competent and capable of DNA binding. In summary, we found efficient transactivation of HBS motif by WT and His273-p53. Studies of COS-1 and 293 cells suggest that a proportion of p53 in transformed cells display wild-type DNA binding and TA properties and that expression of transcriptionally inactive mutant p53 proteins in these cells does not interfere with WT-dependent transactivation.
 ...
PMID:Analysis of p53 transactivation through high-affinity binding sites. 841 2

The overexpression of P-glycoprotein is thought to be responsible for resistance to chemotherapy in some non-responsive cancers. The mechanism by which P-glycoprotein is overexpressed in human tumors is poorly understood. However, several lines of evidence suggest that the major regulatory mechanism of P-glycoprotein overexpression in human tumors is at the transcriptional level. During tumor progression one of the most commonly observed alterations is mutation of the p53 tumor-suppressor gene. It has been shown that the p53 protein plays a role in transcriptional regulation. To gain insight into the effect p53 protein may have on P-glycoprotein promoter activity, we transiently co-transfected plasmids containing the hamster pgp1 or human mdr1 promoter linked to the chloramphenicol acetyltransferase (CAT) reporter gene with plasmids encoding either wild-type or mutant p53 protein into Chinese hamster ovary (CHO) cells. In this report, we show that wild-type p53 protein represses P-glycoprotein promoter activity, while mutant forms of p53 protein enhance P-glycoprotein promoter activity. Furthermore, we present data which indicate that the transcriptional regulatory effects of p53 are mediated through interactions with pgp1/mdr1 core promoter sequences. These findings have implications for our understanding of the molecular mechanism(s) by which p53 protein functions as a transcriptional regulator of gene expression. In addition, our results suggest a mechanism by which P-glycoprotein may be overexpressed in human cancers that also express mutant forms of p53 protein.
 ...
PMID:The core promoter region of the P-glycoprotein gene is sufficient to confer differential responsiveness to wild-type and mutant p53. 850 78

The p53 protein is a multifunctional transcriptional regulator involved in cellular response to DNA damage and has been implicated as a putative determinant of sensitivity of tumor cells to cytotoxic agents. Since the p53 gene becomes inactivated in over one-half of advanced ovarian carcinoma, in this study we have examined the relationships between p53 gene alterations, p53 immunoreactivity, and response to cisplatin-based chemotherapy in ovarian cancer patients. All patients had advanced (FIGO stage III or IV) ovarian carcinoma and, with one exception, were untreated at the time of collection of tumor specimens. After initial debulking surgery, patients received high-dose cisplatin therapy. Tumor samples were analyzed for p53 gene mutations and for p53 protein accumulation, and the findings were correlated with tumor responsiveness. Of the 33 tumors examined, p53 gene mutations were found in 20 cases, including 15 missense mutations, 2 deletions, 2 nonsense mutations, and a base substitution at splice site. Twenty tumors showed positive immunostaining for p53. Only missense mutations were associated with positive immunostaining. In addition, p53 overexpression was detected in five tumors in the absence of mutations. Most (12 of 14) of the missense mutations associated with p53 protein stabilization were found refractory to therapy, as well as tumors overexpressing wild-type p53 (4 of 5). A significant correlation has been found between p53 accumulation, type of mutation (i.e., missense mutations), and pathological response to cisplatin-based therapy. In conclusion, the present results are consistent with a role of p53 as a determinant of chemosensitivity of ovarian carcinoma.
 ...
PMID:A comparative study of p53 gene mutations, protein accumulation, and response to cisplatin-based chemotherapy in advanced ovarian carcinoma. 863 Sep 96


1 2 3 4 5 6 7 8 9 10 Next >>