Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
 77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

An immune-selection procedure was employed in order to isolate p53-binding sites from rat genomic DNA. One such site was found to reside within the first intron of the cyclin G gene. Cyclin G mRNA levels are strongly elevated upon induction of wild type p53 activity in cells carrying a temperature sensitive p53 mutant. The cyclin G gene also carries a second p53-binding motif upstream to its transcriptional start site. The presence of two high affinity p53-binding sites may confer upon the cyclin G gene the potential to be activated very efficiently by p53. These data raise the possibility that cyclin G may be a downstream mediator of at least some of the biological effects of p53.
 ...
PMID:Identification of p53 target genes through immune selection of genomic DNA: the cyclin G gene contains two distinct p53 binding sites. 778 84

Through a PCR-based differential screening method, cyclin G was identified as a novel transcriptional target of the p53 tumor suppressor gene product. In both a mouse p53 temperature-sensitive leukemic cell line and mouse embryonic fibroblasts (MEF) after gamma-irradiation, cyclin G mRNA was rapidly induced. MEF from a p53-deficient mouse expressed cyclin G at a level > 10-fold lower than that from a wild-type mouse. Using a DNA binding assay, a specific p53 binding site was identified upstream from the cyclin G gene, which functioned as a p53-dependent cis-acting element in a transient transfection assay. These results suggest that cyclin G might participate in a p53-mediated pathway to prevent tumorigenesis.
 ...
PMID:Cyclin G is a transcriptional target of the p53 tumor suppressor protein. 795 50

In a search for effectors and targets of UVB signaling in mammalian cells, we screened a keratinocyte cDNA library with differentially subtracted UVB-enriched cDNA probes. One of the UVB induced cDNA clones proved to be the rat p21Cip1/WAF1 homologue. UVB irradiation caused a rise in p53 protein levels, in association with induction of p21Cip1/WAF1 and cyclin G expression. The effects of UVB irradiation induced p21Cip1/WAF1 on the cell cycle were examined. In contrast to gamma irradiation, which caused G2 arrest, UVB treatment of asynchronous neonatal rat keratinocytes (NK) led to a marked inhibition of replicative DNA synthesis and prolonged G1 and S phase arrests, persisting to 18-24 h, with recovery of cycling by 36 h post-UVB. G1 arrest was accompanied by inhibition of cyclin D-, E- and A-associated kinases. Kinase inhibition was not due to reduction in cyclin or cdk proteins. While the association of cyclin E with Cdk2 was moderately reduced, cyclin D1/Cdk4 and cyclin A/Cdk2 complexes were not disrupted. The activating threonine 160 phosphorylation of Cdk2 in cyclin complexes was not inhibited. An incremental binding of p21 with Cdk4 paralleled the inhibition of cyclin D1/Cdk4 kinase and a similar rise in Cdk2 binding to p21 was associated with inhibition of cyclin E and cyclin A dependent kinases. Furthermore, a rise in measurable p21Cip1/WAF1-Cdk2 inhibitory activity paralleled the loss of G1 cyclin-dependent kinase activity, supporting a role for p21Cip1/WAF1 in the UVB-induced checkpoints.
 ...
PMID:UVB radiation induces p21Cip1/WAF1 and mediates G1 and S phase checkpoints. 862 54

Several genes have been identified as targets for transcriptional activation by the p53 tumour suppressor protein. Rodent cyclin G was previously identified as a p53 responsive gene and in order to assess the role played by cyclin G as a mediator of p53 function in humans cells we have isolated full length human cyclin G1 and identified a related gene designated cyclin G2. Both human G-cyclins are induced by the DNA damaging agent actinomycin-D and although the induction of cyclin G1 is clearly p53 dependent, activation of cyclin G2 expression was observed in the absence of p53. Based on sequence similarity, the G-cyclins and the recently identified cyclin I form a distinct sub-group within the larger cyclin family, possibly reflecting some degree of functional similarity.
 ...
PMID:Characterisation of human cyclin G1 and G2: DNA damage inducible genes. 880 1

An increase in cyclin G expression after nerve injury was demonstrated by differential display PCR, carried out to compare references in expression of mRNAs between axotomized and normal hypoglossal motoneurons in the rat. The nerve injury dramatically upregulated the expression of cyclin G mRNA in the motoneurons during the early phase of the nerve regeneration process, suggesting an involvement of cyclin G in the early stage of nerve regeneration. In brain, in situ hybridization studies also demonstrated cyclin G expression in a restricted group of matured neurons, particularly in the telencephalon and the thalamus. This constitutive expression in mature neurons suggests that cyclin G may have a function different from other members of the cyclin group. In addition, although cyclin G has been shown to be a transcription target of p53, the upregulation of cyclin G in injured motoneurons, as well as the expression in the adult rat brain, was not affected in the p53-deficient mouse. These data suggest that the expression of cyclin G, at least in the nervous system, is not regulated by p53 predominantly, and that there may be alternative regulatory factors or pathways for cyclin G expression.
 ...
PMID:p53-independent cyclin G expression in a group of mature neurons and its enhanced expression during nerve regeneration. 881 78

We and others previously showed that cyclin G is a transcriptional target of the p53 tumor suppressor protein. However, cellular proteins which might form a complex with cyclin G have not yet been identified. To gain insight into the biological role of cyclin G, we used the yeast two-hybrid screen and isolated two mouse cDNAs encoding cyclin G-interacting proteins. Interestingly, both positive cDNAs encoded B' regulatory subunits of protein phosphatase 2A (PP2A). One clone encodes B'alpha, while the other clone codes for a new member of the B' family, B'beta. B'beta is 70% identical to other members of the B' family. B'alpha associated both in vitro and in vivo with cyclin G but not with the other mammalian cyclins. Furthermore, cyclin G formed a complex with B'alpha only after induction of p53 in p53 temperature-sensitive cell lines. These results indicate that cyclin G forms a specific complex with the B' subunit of PP2A and that complex formation is regulated by p53. Potential roles for the cyclin G-B' complex in p53-mediated pathways are discussed.
 ...
PMID:p53-dependent association between cyclin G and the B' subunit of protein phosphatase 2A. 888 88

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.
 ...
PMID:Structure and chromosomal assignment of the human cyclin G gene. 895 86

The tumor suppressor protein p53 is phosphorylated at multiple sites in the amino-terminal transactivation domain and at several sites in the carboxy-terminal region. Phosphorylation appears to modulate its DNA binding activity. Here we demonstrate that phosphorylation of p53 also modulates its transcriptional activity. Okadaic acid treatment of cells resulted in enhanced phosphorylation of p53 and concomitantly in enhanced transactivation of an mdm2 promoter-linked luciferase reporter gene. This effect was cell type specific, however, since transactivation was enhanced in rat and mouse fibroblasts but reduced in the human Saos-2 cell line. Moreover, the effect was dependent on the promoter. In rat cells transcription from the mdm2, waf1 (cip1) and bax gene promoters, and the artificial PG13 promoter was enhanced by okadaic acid treatment whereas that from the cyclin G promoter was reduced. When various phosphorylation site mutants of p53 were tested for transactivation of these promoters, they behaved differently. Amino-terminal mutants exhibited reduced transcriptional activities on mdm2, waf1 and cyclin G promoters but enhanced activities with bax and PG13 promoters. On the other hand, a mutant at the cdk phosphorylation site, A313, showed reduced activity with mdm2 and waf1 promoters but enhanced activity with the cyclin G promoter, and finally, mutant A390 exhibited enhanced activity on waf1 and bax promoters, but reduced activity on the cyclin G promoter. These results suggest that phosphorylation of p53 may have different effects on its transcriptional activity, depending on the cellular environment and the particular response element. Moreover, both, amino- and carboxy-terminal phosphorylation sites seem to be involved in modulating the DNA-binding and the transactivation activities.
 ...
PMID:Differential effects of phosphorylation of rat p53 on transactivation of promoters derived from different p53 responsive genes. 900 Jan 27

Among the p53-regulated genes that have been identified thus far, cyclin G is a relatively recent one. We conducted a series of experiments aimed at elucidating cyclin G function. Ectopic overexpression of cyclin G in human RKO colon carcinoma cells accelerated cell growth. Transfection of normal human fibroblasts with the cyclin G expression vector promoted clonal expansion. Cyclin G immune complexes isolated from the transfected cells exhibited appreciable levels of cyclin-dependent kinase activity, as evidenced using histone H1 as a substrate. The retinoblastoma protein, pRb, was detectable in cyclin G immune complexes, raising the possibility that Rb may be one mediator of cyclin G action. Cyclin G-overexpressing cells were more sensitive to cisplatin cytotoxicity than the parent cells, probably because cyclin G overexpression overrides cell cycle checkpoint(s). Overexpression of another p53-regulated gene, GADD45, by contrast, protected cells from cisplatin killing. These findings suggest that different downstream effectors of the p53 pathway may exert different effects on cellular survival after treatment with cancer chemotherapy drugs such as cisplatin.
 ...
PMID:The p53-regulated cyclin G gene promotes cell growth: p53 downstream effectors cyclin G and Gadd45 exert different effects on cisplatin chemosensitivity. 901 7

A murine erythroleukemic cell line (1-2-3) which expresses only the temperature-sensitive mutant p53 gene (Ala-to-Val substitution at codon 135) was established. When these cells were cultured at 32 degrees C, the growth rate was reduced significantly and DNA fragmentation, a typical character of apoptosis, was observed. In this process, p53 migrated from cytoplasm to nucleus and protein complexes binding to the p53-responsive element were detected in nuclear extracts of the cells cultured at 32 degrees C by gel-shift assay and transactivation from the p53-responsive element was detected. The expression of the p21 (waf1/cip1/sdi1), cyclin G and gadd45 genes was increased (about 3 to 4 fold that at 37 degrees C), when the cells were cultured at 32 degrees C. However, the expression of the bax gene was increased slightly (about 1.5 fold that at 37 degrees C) and no significant change was detected in expression of the mdm2 gene. No change in the amount of Fas antigen was observed by flow cytometric analysis. Transcripts of the bcl-2 and fasl gene were not detected in the cells both at 37 degrees C and 32 degrees C. These results suggest that up-regulation of the genes associated with the cell cycle and/or DNA replication, such as p21, cyclinG and gadd45 rather than bax, fas, fasl and bcl-2 may be important for induction of apoptosis of this erythroleukemic cell line by p53.
 ...
PMID:Up-regulation of cell cycle-associated genes by p53 in apoptosis of an erythroleukemic cell line. 920 1


1 2 3 4 5 Next >>