Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
 77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Neuroblastoma is a common childhood malignancy of the sympathetic nervous system. Mutations in p53, a tumor suppressor gene located on the short arm of chromosome 17, are one of the most common genetic lesions in human cancers. The evidence for trisomies of 17q with loss of 17p in some cases of neuroblastoma led us to consider whether p53 mutations might contribute to the onset and progression of this malignancy. In this study, primary tumors from 38 neuroblastoma patients were screened for mutations within the coding exons of the p53 gene by single-strand conformation polymorphism analysis, and potential mutations were further analyzed by nucleotide sequence analysis. Previously described sequence variations were detected in many of the tumors, including a silent polymorphism at codon 213 (CGA to CGG) and the nontransforming Pro to Arg substitution at codon 72 (CCC to CGC). However, no other sequence variations were detected within the coding portions of the p53 gene. This finding suggests that p53 mutations do not contribute to the etiology of neuroblastoma and that the chromosome 17 alterations observed in neuroblastoma involve genes which are distinct from the p53 locus.
 ...
PMID:Absence of p53 gene mutations in primary neuroblastomas. 822 61

We have investigated the frequency of p53 gene mutations in Ewing's sarcoma (ES) and neuroblastoma (NB) by using polymerase chain reaction-single strand conformation polymorphism analysis for genomic DNA or complementary DNA generated from total RNA. Mutations of the p53 gene were found in six of seven ES cell lines: a missense mutation of TGC (Cys)-->TAC (Try) at codon 141 in one, a missense mutation of CGT (Arg)-->TGT (Cys) at codon 273 in one, a missense mutation of TGC (Cys)-->TTC (Phe) at codon 176 in three, and one base deletion of CGC-->CG at codon 283 in one. Further analysis of 14 ES and related primary tumors showed mutations of the p53 gene in only two: one base insertion of CCG-->CCCG at codon 152 in one and a missense mutation of GGC (Gly)-->GTC (Val) at codon 154 in the other. Both of the two tumors were obtained from patients with an advanced stage disease. Three of the eight ESs with mutations of the p53 gene showed the same missense mutation at codon 176, suggesting the mutational hot spot of the p53 gene in ESs. In contrast to ES, none of 6 NB cell lines or 48 NB tumors including advanced-stage ones with or without N-myc amplification showed any aberration of the p53 gene. Our findings suggest that mutations of the p53 gene in ES might represent late genetic events related to tumor progression, and that aberrations of the p53 gene might not be involved in the development or the progression of NB.
 ...
PMID:Mutations of the p53 gene are involved in Ewing's sarcomas but not in neuroblastomas. 822 63

Mutations in, and aberrant expression of, the p53 tumor suppressor gene were assessed in 17 cell lines derived from human malignant brain tumors (glioblastoma multiforme). Exons 5 through 8 were screened by single strand conformational polymorphism analysis (SSCP), followed by direct DNA sequencing. Mutations were found in 6 of 17 glioma cell lines, i.e., at a frequency similar to that found in primary malignant gliomas. Loss of the wild type allele was observed in 4 of the mutated cell lines. Two cell lines had the same mutation (CGG-->TGG; Arg-->Trp) in codon 248. Five of 6 mutations were transitions, 4 of which occurred at CpG dinucleotides. In one cell line a 10-bp deletion at the intron 4/exon 5 junction was found. Five of 6 glioma cell lines contained a mutation identical to that in the respective primary tumor despite prolonged in vitro culture (140-221 passages). Thus, the acquisition of p53 mutations during culture appears to be infrequent. Two cell lines derived from heterozygous tumors maintained the wild type p53 allele during long term culture. p53 protein levels were assessed by immunofluorescence cytochemistry and immunoprecipitation followed by Western blot analysis and revealed elevated levels of the p53 protein, although to a variable extent, in all cell lines with p53 mutations. A marked p53 protein accumulation was also observed in two cell lines lacking p53 mutations in exons 5 through 8, indicating that a prolonged half life of the gene product is not solely dependent on an aberrant coding sequence. The remaining cell lines had either low levels or no detectable p53 protein; one of the latter contained a gross rearrangement of the p53 gene. Our results suggest that with respect to p53 gene status, glioma cell lines usually resemble the original tumors and may, therefore, be suitable for studying the biological changes associated with p53 mutations in glial tumors.
 ...
PMID:p53 protein accumulation and gene mutations in human glioma cell lines. 825 36

An in vitro model system for xenogenization has been developed in which an immunogenic, nonmalignant phenotype was selected from a highly malignant T-cell line (S49). We showed by single-strand conformation polymorphism and DNA sequence analysis that specific point mutations in the p53 tumor suppressor gene correlated with a change from a tumorigenic to a nontumorigenic (immunogenic) phenotype. Specifically, we found that the highly malignant S49 cell line T-60 contains an Arg-->Gln substitution at residue 246 in exon 7 of p53. In contrast, nontumorigenic (immunogenic) variants (T-25-Adh and Rev-1) exhibited a Gly-->Ser substitution at residue 242 of p53. In two subsequent tumorigenic revertants derived from Rev-1, we again found the Arg-->Gln substitution at residue 246 that was found initially in the T-60 cells. Thus, mutation at residue 246 of p53 was associated with a highly malignant phenotype, whereas a novel mutation at residue 242 of p53 appeared to be associated with a nonmalignant phenotype and may have actually protected the host through immunization. We conclude that mutation of residue 242 may represent a new class of permissive (nonmalignant) mutations in the mouse that are analogous to the Li-Fraumeni mutation in humans.
 ...
PMID:Association of tumorigenic and nontumorigenic (immunogenic) variants in a mouse T-cell lymphoma with two distinct p53 mutations. 828 Mar 70

Accumulation of p53 protein resulting in levels detectable by immunohistochemistry (IHC) has been proposed as an indicator of mutation of the p53 gene. We have investigated a panel of 23 fresh-frozen breast cancers by IHC (PAb 1801), Southern and Northern blot analysis, and direct sequencing of the mutation hot spot regions (exons 5-8) of the p53 gene. Three tumors (13%) showed an intense nuclear staining in the majority of malignant cells, but only one of these showed a mutation of the p53 gene (codon 237, Arg to His). Furthermore, a mutation (5-bp deletion) was identified in a tumor that showed no p53 immunoreactivity. Our results indicate that accumulation of p53 protein, as detectable by IHC, is not a reliable indicator for p53 gene mutation in human breast cancer.
 ...
PMID:Accumulation of p53 protein as an indicator for p53 gene mutation in breast cancer. Occurrence of false-positives and false-negatives. 828 24

The tumor suppressor p53 exerts important protective functions towards DNA-damaging agents. Its inactivation by allelic deletions or point mutations within the P53 gene as well as complex formation of wildtype p53 with cellular or viral proteins is a common and crucial event in carcinogenesis. Mutations increase the half-life of the p53 protein allowing the immunohistochemical detection and anti-p53 antibody formation. Distinct G to T point mutations in codon 249 leading to a substitution of the basic amino acid arginine by the neutral amino acid serine are responsible for the altered functionality of the mutant gene product and were originally identified in 8 of 16 Chinese and 5 of 10 African HCC patients. Both groups are frequently exposed to mycotoxin contaminations of their food. Today an average P53 gene mutation rate of 25% is assumed for high-aflatoxin B1-exposure regions. This is double the rate observed in low-aflatoxin B1-exposure countries. Although many HCC patients displaying P53 mutations also suffer from HBV infection, which itself can lead to rearrangements of P53 coding regions or induce the synthesis of viral proteins possibly interacting with p53, the specific G to T transversion within codon 249 of the P53 gene seems to directly reflect the extent of aflatoxin B1 exposure.
 ...
PMID:Point mutations of the P53 gene, human hepatocellular carcinoma and aflatoxins. 830 Oct 66

In this study, rat embryo lung organ cultures were exposed to benzo[a]pyrene (B[a]P). After carcinogen-treatment the cells were dissociated and an epithelial cell line (BP) was developed from the primary cell culture derived from the carcinogen-treated explants. Investigations were performed on the sequential changes occurring in the course of neoplastic progression of BP cells and in the tumor cells that arose in vivo from implanted BP cells. During the neoplastic progression a mutation was shown to occur in p53 gene at codon 130 (AAG > AGG; Lys > Arg) in a single cell which expanded and gave rise to a predominant subpopulation. This mutational event was already detected at passage 14 but was probably not a direct consequence of a specific alteration caused by the carcinogen in the target cell. This mutation was retained through the subsequent progressional steps first as a heterozygous mutation, then converted to a homozygous state. From passage 18 on, it was possible in BP cell cultures to detect foci of larger morphologically distinct cells emerging on a background of cells maintaining the original morphology. These foci were shown to derive from a single cell carrying the p53 mutation in a homozygous state. During the neoplastic progression the mutant p53 allele frequency steadily increased and this mutant allele eventually came to predominate completely in the late stages of the neoplastic progression, including in the transplantation-induced tumors. The pattern of a directional selection for mutant p53 gene towards fixation is probably applicable to a wide range of human malignancies and may reflect the particular importance of this gene for tumorigenesis.
 ...
PMID:Directional selection associated with clonal expansion of p53 mutant cells during neoplastic development of carcinogen-treated rat embryo lung epithelial cells. 830 88

Activating mutations within the p53 gene cause stabilization and therefore increased steady-state levels of the p53 protein; some, but not all, also result in the generation of an epitope recognized by the antibody pAB240. We have shown here that in 70% of Burkitt lymphoma cell lines, but not in normal EBV transformed B cell lines, p53 protein is readily detectable by Western blot analysis using either an antibody directed against the 240 epitope or an antibody against wild-type p53. Genomic analysis of these BL cell lines demonstrated the presence of mutations within the p53 gene in all cell lines with detectable p53 protein. We have also shown that in the cell lines ST486, Raji, and TE 110, which are heterozygous for a neutral sequence codon polymorphism (Arg/Pro) that causes altered migration of an otherwise normal protein and also contain a heterozygous mutation, only the protein derived from the mutated allele is stabilized. Thus the dominant effect of the mutations present in these cell lines apparently does not result from sequestering of the normal protein by the abnormal protein, and therefore presumably is a consequence of a gain-of-function resulting from the mutation. Although all cell lines with stabilized p53 also contained p53 mutations, three lymphoid tumors (two cell lines and one fresh B-CLL) with a heterozygous mutation at codon 248 did not express elevated levels of p53. In contrast, p53 was readily detectable in Western blot analysis from cell lines KK124, Namalwa, and CA46, which had homo- or hemizygous mutations at codon 248, and from PP1084, a cell line with a codon 273 mutation and a carboxyl-terminal truncation in the other allele. These results suggest that mutations at codon 248, unlike those in cell lines ST486 and TE110, are stabilizing only in the absence of the wild-type p53. Heterozygous mutations at codons 248 have been described in the germline of individuals belonging to cancer-prone families described by Li and Fraumeni (see ref 18), but tumors detected in such individuals are homozygous, i.e., contain only mutated p53. This is consistent with the possibility that such mutations exert a pathogenetic effect only in the absence of the wild-type protein, and are coupled to our findings that stabilization of p53 is a necessary component of the oncogenic pathways relevant to p53. However, whereas some mutations are stabilizing in the presence of the normal p53 protein, others are stabilizing only in the homozygous state.
 ...
PMID:Hemi- or homozygosity: a requirement for some but not other p53 mutant proteins to accumulate and exert a pathogenetic effect. 834 93

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.
 ...
PMID:Novel DNA binding of p53 mutants and their role in transcriptional activation. 836 64

The prevalence and type of mutations in the p53 tumour-suppressor gene have been determined in 15 hepatocellular carcinomas (HCC) originating from Thailand. Direct sequencing of exons 5-8 revealed 2 mutations, an AGG to AGT (Arg-->Ser) transversion at codon 249, and an ATC-->AAC (Ile-->Asn) transversion at codon 254. Samples from the Thai patients were analyzed for the presence of aflatoxin-liver DNA and aflatoxin-serum albumin adducts, and all but one were found negative. All the patients were genotyped for glutathione-S-transferase (GST) mu, an enzyme possibly involved in the detoxification of AFB1, and 12 out of 15 had the null genotype. In general, the level of aflatoxin-albumin adducts in sera and the prevalence of p53 mutation at codon 249 in HCC were lower than in other areas at high risk of HCC, including southern China and parts of Africa.
 ...
PMID:p53 mutations and aflatoxin B1 exposure in hepatocellular carcinoma patients from Thailand. 838 58


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>