Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
 77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Recent advances in cancer biology have clearly demonstrated that the development of neoplasms as well as their progression are strictly linked to the alteration of molecular mechanisms controlling the cell division cycle. Among these mechanisms the functional inactivation of two important tumor suppressor genes, namely RB1 and p53, has been widely recognized as a pivotal step in human cancerogenesis. In addition to such well-known genes, a new tumor suppressor gene, mapping on chromosome 9p21, has recently been identified and cloned. Several findings suggest that its loss of function is involved in the initiation and/or progression of an enormous number of different malignancies. This gene, named p16INK4, codifies for a small protein capable of binding to, and thus of inhibiting, some specific cyclin-dependent threonine-serine kinases that represent key enzymatic activities essential for the G1-S transition in mammalian cells. This review will summarize some aspects of the cell cycle control mechanisms, with major emphasis devoted to the role played by this recently characterized inhibitor and to the possible linkage between its inactivation and cancer formation. In particular, we will discuss these aspects in the light of the role of p16INK4 gene inactivation in the development of human acute lymphoblastic leukemias. Indeed this gene seems to be the first, and so far the only tumor suppressor gene consistently altered in specific acute hematological malignancies. Finally, future trends in the investigation of cell cycle control and leukemogenesis will be analyzed.
 ...
PMID:Cell cycle regulation and human leukemias: the role of p16INK4 gene inactivation in the development of human acute lymphoblastic leukemia. 864 24

Cancer-related mutations of the p53 tumor suppressor gene are clustered in the four so-called 'hot spots', codons 175, 248, 273 and 281/282. By using recombination PCR in vitro mutagenesis, we introduced point mutations into the codon 273 of wild-type (wt) p53 (pC53-SN3) from Arg to His (pC53-273H [273H]), Asp (273D), Pro (273P), Lys (273K), Leu (273L) or Thr (273T), and compared their biological and biochemical activities with wt p53 and cancer-derived 175H, 248W and 273H/309S. Among them, 273H/309S, 273H and 273D as well as wt p53 transactivated the chloramphenicol acetyltransferase (CAT) gene placed downstream of the p53 binding consensus, while none of the other mutants including 273L did. Transcriptions from human c-fos and rat PCNA promoters were suppressed by wt p53 and 273D, while they were enhanced variously by all other mutants in Saos-2 and/or NIH3T3 cells. On the other hand, growth of human squamous carcinoma cell lines measured by the plating efficiency of G418-resistant colonies was enhanced by transfection of 175H, 248W, 273H/309S and 273P, while suppressed by not only wt p53, 273D and 273H but also 273L. Thus, 273H/309S enhanced cell growth in spite of its p53-specific transactivation activity, while 273L suppressed cell growth in spite of its complete loss of the p53-specific transactivation. We concluded that the sequence-specific transactivation of p53 is not always correlated with its growth inhibitory activity.
 ...
PMID:The 273rd codon mutants of p53 show growth modulation activities not correlated with p53-specific transactivation activity. 864 76

There are two points (brake-points) through which the cell must pass before it can enter cell division. Progress through each brake-point requires the presence of an active cyclin-dependent kinase (Cdk). There are specific cyclins to activate the Cdk's at different parts of the cell cycle. Activation of the cyclin-Cdk complex is tightly regulated by the phosphorylation state of the Cdk. Exogenous growth stimulators (hormones, growth factors, and cytokines) all work through an intracellular kinase cascade that drives the production and activation of early nuclear proteins that, in turn, induce transcription of the genes for cyclins, Cdk's, and other cell cycle regulators. Retinoblastoma protein regulates cell division by inactivating specific growth-promoting proteins. Therefore, mutation of the Rb gene can lead to uncontrolled cell division and thus promotion of transformed cells. p53 protein will prevent replication of cells with damaged DNA. Hence, transformed cells can only readily progress to tumors if the p53 gene is mutated in a manner that inactivates the protein product. Members of the bcl-2 family act, in homodimers and heterodimers, to shunt cells either into cell division or into apoptosis. Understanding the mechanisms by which the balance of cell cycle: apoptosis can be manipulated will lead to new ways of controlling abnormal cellular growth. Most aspects of cellular function reflect changes in phosphorylation of critical serine, threonine, and tyrosine residues on the relevant regulatory proteins. The kinases the phosphatases involved are themselves under tight control.
 ...
PMID:The cell cycle and regulation of cancer cell growth. 865 73

p21 is induced by and mediates the effects of p53 in response to DNA damage arresting the cell in G1 or G2, by inhibiting multiple cyclin-cyclin-dependent kinases (CDK) or binding to proliferating-cell nuclear antigen (PCNA), respectively. To determine whether p21 mutants occur in tumors we examined DNA from 188 primary non-Hodgkin's B-cell lymphoma (NHL) tumors and 84 chronic myelogenous leukemia samples for mutational changes in the coding region of p21 by single-strand conformation polymorphism (SSCP) analysis and direct sequencing of polymerase chain reaction (PCR)-amplified DNA. We did not find mutations in the coding region in these two tumor types. We identified a polymorphic nucleotide change in codon 31 in which a transversion from C to A substituted amino acid arginine for serine. Three of 188 NHL tumors were homozygous for this change, but they were not identified in 84 CMLs or in 97 normal controls. On the other hand, in one CML case a transition from G to A in codon 64 substituted amino acid threonine for alanine. These data do not indicate that derangements in the coding region of p21 contribute to the initiation and/or progression of these tumors.
 ...
PMID:Absence of somatic changes in p21 gene in non-Hodgkin's lymphoma and chronic myelogenous leukemia. 865 61

The cyclin-dependent kinase (CDK) inhibitor p21 is induced by the tumor suppressor gene product p53 and is thought to be important for the arrest of the cell cycle following DNA damage. Here we have investigated the contribution of p21 in inhibiting different cyclin-CDK complexes that drive different cell cycle transitions following UV irradiation-induced DNA damage in normal human fibroblasts and immortalized rodent fibroblasts. When cells were exposed to a low dose of UV irradiation, both p53 and p21 were induced; the protein kinase activities associated with Cdc2, Cdk2, and Cdk4 were inhibited; and there was a good correlation between their inhibition and binding to p21. p21 alone is likely to be sufficient for the inhibition of Cdk2 because all the cyclin-complexed forms of Cdk2 were associated with p21 after irradiation. In contrast, only a small proportion of Cdk4 and Cdc2 was complexed with p21, although the level of Cdk4 associated with either p21 or p27 was increased after irradiation. Furthermore, recombinant p21 added to an unirradiated cell lysate at the same level as that induced by irradiation damage inhibited only the kinase activity associated with Cdk2. Cdc2 is likely to be inhibited by Thr-14/Tyr-15 phosphorylation after irradiation because Cdc2 was tyrosine-phosphorylated, and recombinant Cdc25 was able to increase its kinase activity significantly. Taken together, these results suggest that different CDKs are inhibited by different mechanisms following UV-induced DNA damage: Cdk2 is inhibited by the elevated level of p21; Cdk4 is inhibited by cooperation of p21 with other CDK inhibitors, like p27, and possibly by phosphorylation; and Cdc2 is inhibited by Thr-14/Tyr-15 phosphorylation. It is likely that these underlying mechanisms that inactivate CDKs are similar for other kinds of DNA damage.
 ...
PMID:Cyclin-dependent kinases are inactivated by a combination of p21 and Thr-14/Tyr-15 phosphorylation after UV-induced DNA damage. 866 25

The p53 tumour suppressor protein is thought to play a major role in the defence of the cell against agents which damage DNA. p53 is phosphorylated at multiple sites in vivo and by several different protein kinases in vitro. In this report, we have examined the phosphorylation of murine p53 by protein kinase C (PKC). Phosphopeptide mapping, phosphoamino acid analysis and radiosequence analysis of p53 phosphorylated by PKC in vitro indicated that serine 370 and threonine 377 were the major targets for phosphorylation and suggested that serine 372 and threonines 365 and 371 were minor phosphorylation sites. Site-directed mutagenesis confirmed that residues 370-372, all of which lie within the epitope for monoclonal antibody PAb421, were phosphorylated in vitro. The p53 from 32P-labelled SV3T3 cells showed a phosphopeptide pattern which includes peptides with mobilities similar to those arising from phosphorylation of residues 370-372 by PKC in vitro. Only two of these in vivo-labelled phosphopeptides co-migrated in two dimensions with peptides labelled in vitro within the PAb421 epitope and their phosphorylation was not stimulated by the addition of the PKC activator o-tetradecanoylphorbol 13-acetate (TPA) to the cells, even though this treatment led to a fourfold stimulation of p53 phosphorylation by MAP kinase. Moreover, when the p53 proteins containing mutations at residues 370-372 were expressed in COS cells, there was no loss of any of the in vivo phosphopeptides, indicating that phosphorylation within the PAb42I epitope was undetectable in the cell. These data suggest that p53 and PKC may not interact in vivo. The two-dimensional migration pattern of the novel group of peptides is consistent with phosphorylation of previously uncharacterised sites within the central DNA binding region of p53.
 ...
PMID:Murine p53 is phosphorylated within the PAb421 epitope by protein kinase C in vitro, but not in vivo, even after stimulation with the phorbol ester o-tetradecanoylphorbol 13-acetate. 870 May 48

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.
 ...
PMID:Structure and chromosomal assignment of the human cyclin G gene. 895 86

Okadaic acid (OA) is a serine/threonine protein phosphatase inhibitor and has been shown to induce apoptosis in a number of different tumor cell lines, including human breast carcinoma (HBC) cells. The molecular basis of OA-induced apoptosis remains to be investigated. Here, we demonstrate that the OA concentration that inhibits only protein phosphatase 1 and 2A was sufficient to induce apoptosis in HBC cells. In MCF-7 cells, the OA-induced apoptosis was coupled with the overexpression of endogenous p53, p21Waf1/Cip1, and Bax proteins, whereas the Rb protein levels were decreased. OA also induced apoptosis and concomitantly enhanced the p21Waf1/Cip1 and Bex levels in human papilloma virus protein E6-transfected variants of MCF-7 cells, in which p53 function had been disrupted. OA, by contrast, had no effect on the levels or the subcellular localization of Gadd45 and Bcl2 proteins in either wild-type of E6-transfected MCF-7 cells. Bcl-xL, Bcl-xS, and Bak levels were also unchanged after OA treatment in both cell types. OA-induced apoptosis and its effect on the expression of the above molecular markers occurred in the absence of any detectable changes in the cell cycle phase distribution. On the basis of our findings, we conclude the following: (a) OA-induced apoptosis in HBC cells occurs independently of cell cycle arrest; (b) the wild-type p53 function is not an absolute prerequisite for OA-induced cell death; and (c) OA-induced apoptosis is associated with up-regulation of endogenous p21Waf1/Cip1 and Bax protein levels.
 ...
PMID:Cell cycle-independent regulation of p21Waf1/Cip1 and retinoblastoma protein during okadaic acid-induced apoptosis is coupled with induction of Bax protein in human breast carcinoma cells. 895 27

The adenovirus type 5 55-kDa E1B protein (E1B-55kDa) cooperates with E1A gene products to induce cell transformation. E1A proteins stimulate DNA synthesis and cell proliferation; however, they also cause rapid cell death by p53-dependent and p53-independent apoptosis. It is believed that the role of the E1B-55kDa protein in transformation is to protect against p53-dependent apoptosis by binding to and inactivating p53. It has been shown previously that the 55-kDa polypeptide abrogates p53-mediated transactivation and that mutants defective in p53 binding are unable to cooperate with E1A in transformation. We have previously mapped phosphorylation sites near the carboxy terminus of the E1B-55kDa protein at Ser-490 and Ser-491, which lie within casein kinase II consensus sequences. Conversion of these sites to alanine residues greatly reduced transforming activity, and although the mutant 55-kDa protein was found to interact with p53 at normal levels, it was somewhat defective for suppression of p53 transactivation activity. We now report that a nearby residue, Thr-495, also appears to be phosphorylated. We demonstrate directly that the wild-type 55-kDa protein is able to block E1A-induced p53-dependent apoptosis, whereas cells infected by mutant pm490/1/5A, which contains alanine residues at all three phosphorylation sites, exhibited extensive DNA fragmentation and classic apoptotic cell death. The E1B-55kDa product has been shown to exhibit intrinsic transcriptional repression activity when localized to promoters, such as by fusion with the GAL4 DNA-binding domain, even in the absence of p53. Such repression activity was totally absent with mutant pm490/1/5A. These data suggested that inhibition of p53-dependent apoptosis may depend on the transcriptional repression function of the 55-kDa protein, which appears to be regulated be phosphorylation at the carboxy terminus.
 ...
PMID:Regulation of p53-dependent apoptosis, transcriptional repression, and cell transformation by phosphorylation of the 55-kilodalton E1B protein of human adenovirus type 5. 909 35

The p21WAF1/CIP1 gene is regulated by p53 and encodes a cyclin-dependent kinase (Cdk)-inhibitor involved in senescence and cell quiescence. The role of p21 as a negative regulator of cell proliferation suggests that it may function as a tumor suppressor gene. However, only a few mutations of the p21WAF1/CIP1 gene have been reported to date. In order to assess potential p21WAF1/CIP1 gene alterations in human bladder cancer, we have examined this gene and its encoded product in a well-characterized cohort of 27 primary bladder tumors. Mobility shifts by single-strand conformation polymorphism in the p21WAF1/CIP1 gene were identified in 2 cases. Sequencing analyses revealed that one of these cases had point mutations in the 3' untranslated region, while the other case had a frame shift mutation at positions 322 (C to A) and a deletion of 8 nucleotides (323-->331; CCG-->ACG, codon 81 Arg-->Thr) that produced a stop signal at codon 83 (Gly--Stop). This tumor had a p21-negative phenotype by immunohistochemistry, but did not lose any allele. We further characterized these cases by the study of TP53 mutations using single-strand conformation polymorphism (PCR-SSCP) and sequencing, as well as immunohistochemical assays. Seven mobility shifts were identified and seven cases showed p53 nuclear accumulation. The two cases displaying mutated p21WAF1/CIP1 had wild-type TP53. It is concluded that p21WAF1/CIP1 gene aberrations are infrequent in bladder carcinoma but may be occasionally identified in primary bladder tumors.
 ...
PMID:Analysis of p21WAF1/CIP1 in primary bladder tumors. 911 33


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>