Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
 77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.
 ...
PMID:Novel DNA binding of p53 mutants and their role in transcriptional activation. 836 64

The p53 tumour suppressor protein is a potent transcription factor which plays a central role in the defence of cells against DNA damage and the propagation of malignant clones. We have previously shown that phosphorylation of serine 386 in mouse p53 by the growth- associated protein kinase, casein kinase II (CKII), plays an important role in the ability of p53 to block the proliferation of drug-resistant colonies. In this paper we show that blocking phosphorylation of serine 386 through an alanine substitution, or placing a constitutive negative charge at this position in the form of aspartate, had no significant influence on p53-dependent transcriptional activation of a promoter containing 13 copies of a p53 consensus binding sequence, or of the p21WAF1 promoter which is a natural target for p53. In contrast, the alanine mutant showed a weak reduction in the ability of p53 to repress expression from the c-fos promoter, which is a target for p53-dependent repression in vivo. Strikingly, when the repression of the SV40 early promoter was examined, a reduction in the repression capacity of up to 5-fold was observed. Moreover, repression of the SV40 promoter could be partially restored by aspartic acid substitution at the phosphorylation site. These data indicate that phosphorylation at a specific C-terminal site can selectively regulate p53-dependent repression, but not transactivation.
 ...
PMID:Phosphorylation of p53 at the casein kinase II site selectively regulates p53-dependent transcriptional repression but not transactivation. 860 47

Cancer-related mutations of the p53 tumor suppressor gene are clustered in the four so-called 'hot spots', codons 175, 248, 273 and 281/282. By using recombination PCR in vitro mutagenesis, we introduced point mutations into the codon 273 of wild-type (wt) p53 (pC53-SN3) from Arg to His (pC53-273H [273H]), Asp (273D), Pro (273P), Lys (273K), Leu (273L) or Thr (273T), and compared their biological and biochemical activities with wt p53 and cancer-derived 175H, 248W and 273H/309S. Among them, 273H/309S, 273H and 273D as well as wt p53 transactivated the chloramphenicol acetyltransferase (CAT) gene placed downstream of the p53 binding consensus, while none of the other mutants including 273L did. Transcriptions from human c-fos and rat PCNA promoters were suppressed by wt p53 and 273D, while they were enhanced variously by all other mutants in Saos-2 and/or NIH3T3 cells. On the other hand, growth of human squamous carcinoma cell lines measured by the plating efficiency of G418-resistant colonies was enhanced by transfection of 175H, 248W, 273H/309S and 273P, while suppressed by not only wt p53, 273D and 273H but also 273L. Thus, 273H/309S enhanced cell growth in spite of its p53-specific transactivation activity, while 273L suppressed cell growth in spite of its complete loss of the p53-specific transactivation. We concluded that the sequence-specific transactivation of p53 is not always correlated with its growth inhibitory activity.
 ...
PMID:The 273rd codon mutants of p53 show growth modulation activities not correlated with p53-specific transactivation activity. 864 76

The 289-residue (289R) and 243R early region 1A (E1A) proteins of human adenovirus type 5 induce cell transformation in cooperation with either E1B or activated ras. Here we report that Ser-132 in both E1A products is a site of phosphorylation in vivo and is the only site phosphorylated in vitro by purified casein kinase II. Ser-132 is located in conserved region 2 near the primary binding site for the pRB tumor suppressor and, in 289R, just upstream of the conserved region 3 transactivation domain involved in regulation of early viral gene expression. Mutants containing alanine or glycine in place of Ser-132 interacted with pRB-related proteins at somewhat reduced efficiency; however, all Ser-132 mutants transformed primary rat cells in cooperation with E1B as well as or better than the wild type when both major E1A proteins were expressed. Such was not the case with mutants expressing only 289R. In cooperation with E1B, the Asp-132 and Gly-132 mutants yielded reduced numbers of smaller transformed foci. With activated ras, all Ser-132 mutants were significantly defective for transformation and the rare foci produced were small and contained extensive areas populated by low densities of flat cells. In the absence of E1B, all Ser-132 mutants induced p53-independent cell death more readily than virus expressing wild-type 289R. These results suggested that phosphorylation at Ser-132 may enhance the binding of pRB and related proteins and also reduce the toxicity of E1A 289R, thus increasing transforming activity.
 ...
PMID:Importance of the Ser-132 phosphorylation site in cell transformation and apoptosis induced by the adenovirus type 5 E1A protein. 876 48

Expression of the adenovirus E1A oncogene stimulates both cell proliferation and p53-dependent apoptosis in rodent cells. p53 implements apoptosis in all or in part through transcriptional activation of bax, the product of which promotes cell death. The adenovirus E1B 19K product is homologous in sequence and in function to Bcl-2, both of which bind to and inhibit the activity of Bax and thereby suppress apoptosis. The E1B 19K protein also interacts with the nuclear lamins, but the role of this interaction in the regulation of apoptosis is not known. Lamins are, however, substrates for members of the interleukin-1 beta-converting enzyme (ICE) family of cysteine proteases that are activated during apoptosis and function downstream of Bcl-2 in the cell death pathway. lamins are degraded during E1A-induced p53-dependent apoptosis. Lamin A and C are cleaved into 47- and 37-kD fragments, respectively, and the site of proteolysis is mapped to a conserved aspartic acid residue at position 230. The cleavage of lamins during apoptosis is consistent with the activation of an ICE-related cysteine protease down-stream of p53. No lamin protease activity was detected in cells expressing the E1B 19K protein, indicating that 19K functions upstream of protease activation in inhibiting apoptosis. Substitution of the aspartic acid at the cleavage site produced a mutant lamin protein that was resistant to proteolysis both in vitro and in vivo. Expression of uncleavable mutant lamin A or B attenuated apoptosis, delaying cell death and the associated DNA fragmentation by 12 h. Mutant lamin expressing cells failed to show the signs of chromatin condensation and nuclear shrinkage typical of cell death by apoptosis. Instead, the nuclear envelope collapsed and the nuclear lamina remained intact. However, the late stage of apoptosis was morphologically unaltered and formation of apoptotic bodies was evident. Thus, lamin breakdown by proteolytic degradation facilitates the nuclear events of apoptosis perhaps by facilitating nuclear breakdown.
 ...
PMID:Lamin proteolysis facilitates nuclear events during apoptosis. 897 14

Thyroid carcinomas, even when well differentiated, usually appear as hypofunctioning at scintigraphy. We report a case of an aggressive insular thyroid carcinoma presenting as an autonomously functioning thyroid nodule and causing severe thyrotoxicosis. The tumor was metastatic to a cervical lymph node and both lungs. An activating mutation of the TSH receptor gene in both the primary tumor and the lymph node metastasis was found, due to a base substitution at codon 633 (normal guanine at position 1896 replaced by cytosine CAC for GAC causing aspartic acid substitution by histidine). Other known oncogenes (gsp, ras, PTC/ret, trk, met, and p53) were not involved. This is the first description of an activating TSH receptor mutation in a thyroid hyperfunctioning carcinoma in which an aggressive malignant phenotype coexisted with activation of the cAMP cascade and differentiated thyroid functions.
 ...
PMID:Detection of an activating mutation of the thyrotropin receptor in a case of an autonomously hyperfunctioning thyroid insular carcinoma. 936 May 62

In many cell types, the p53 tumor suppressor protein is required for the induction of apoptosis by DNA-damaging chemotherapy or radiation. Therefore, identification of the molecular determinants of p53-dependent cell death may aid in the design of effective therapies of p53-deficient cancers. We investigated whether p53-dependent apoptosis requires activation of CPP32beta (caspase 3), a cysteine protease that has been found to mediate apoptosis in response to ligation of the Fas molecule or to granzyme B, a component of CTL lytic granules. Irradiation-induced apoptosis was associated with p53-dependent activation of CPP32beta-related proteolysis, and normal thymocytes were protected from irradiation by Acetyl-Asp-Glu-Val-Asp-CHO (Ac-DEVD-CHO), a specific inhibitor of CPP32beta. We next examined whether the Fas system is required for p53-dependent apoptosis and whether stimuli that induce activation of CPP32beta induce apoptosis in p53-deficient cells. Thymocytes or activated T cells from Fas-deficient mice were resistant to apoptosis induced by ligation of Fas or CD3, respectively, but remained normally susceptible to irradiation. Thymocytes from p53-deficient mice, although resistant to DNA damage, remained sensitive to CPP32beta-mediated apoptosis induced by ligation of Fas or CD3, or by exposure to cytotoxic T cells. These results demonstrate that DNA damage-induced apoptosis of T cells requires p53-mediated activation of CPP32beta by a mechanism independent of Fas/FasL interactions and suggest that immunological or molecular methods of activating CPP32beta may be effective at inducing apoptosis in p53-deficient cancers that are resistant to conventional chemotherapy or irradiation.
 ...
PMID:p53-dependent DNA damage-induced apoptosis requires Fas/APO-1-independent activation of CPP32beta. 920 51

The human leukemia cell line, HL60 is very sensitive to various apoptotic stimuli and p53-null. The death-related cysteine proteases of the caspases family play a central role in the execution phase of apoptosis, and we recently reported the importance of serine protease activation in camptothecin-induced apoptotic endonuclease activation in HL60 cells. In the present study, we investigated the role of caspases (ICE/CED-3-related cysteine proteases) and serine proteases in cell death induced by the topoisomerase I inhibitor, camptothecin, in HL60 cells and in a cell-free system. We found that CPP32 is activated during camptothecin-induced apoptosis, and that N-benzyloxycarbony-Val-Ala-Asp (O-methyl) -fluoromethyketone (Z-VAD-fmk), a cell permeable caspase inhibitor blocks all features of apoptosis: morphological changes, cleavage of caspase 3 (CPP32/Yama/Apopain) and poly(ADP-ribose) polymerase, lamin B degradation and DNA fragmentation. However, Z-VAD-fmk and two other ICE/CED-3 inhibitors, YVAD-CHO and DEVD-CHO, were inactive in a cell-free system reconstituted from nuclei of untreated HL60 cells and cytosol from camptothecin-treated cells, suggesting that caspases are not required for endonuclease activation or lamin B cleavage in the cell-free system. By contrast, the serine protease inhibitors, 3,4-dichloroisocoumarin (DCI) and L-1-chloro-3-(4-tosylamido)-4-phenyl-2-butanone tosyl-L-phenylalanine chloromethyl ketone (TPCK), abolished the apoptosis-associated biochemical changes induced by camptothecin both in whole cells and in a cell-free system. DCI also inhibited CPP32 cleavage. Taken together, these results suggest that in HL60 cells, both CPP32 and serine proteases are activated in camptothecin-induced apoptosis.
 ...
PMID:Camptothecin-induced apoptosis in p53-null human leukemia HL60 cells and their isolated nuclei: effects of the protease inhibitors Z-VAD-fmk and dichloroisocoumarin suggest an involvement of both caspases and serine proteases. 926 76

Primary peritoneal carcinoma (PPC) is an aggressive malignancy of the female coelomic epithelium. Previously we had analyzed 29 cases of PPC for p53 protein accumulation by immunocytochemistry. P53 was overexpressed in 83% (24 of 29) of PPCs, including 21 tumors with diffuse intense staining of 100% of tumor nuclei and three additional tumors with significant focal staining. Here we report results of a mutational analysis on the entire p53 coding sequence of 22 of these cases (comprising 18 p53-positive and four negative tumors), using single-strand conformation polymorphism (SSCP) and direct sequence analysis. Only 2 of 22 (9%) patients harbored a p53 mutation (which, interestingly, were identical and consisted of a codon 259 Asp --> His exchange), despite diffuse overexpression of high levels of nuclear p53 protein in most cases. This result indicates that (1) the abnormal p53 expression is usually not caused by mutations of the p53 gene in PPC and (2) PPC is part of a growing number of tumors that share evidence of p53 dysfunction in the absence of mutation.
 ...
PMID:Nuclear overexpression of p53 protein does not correlate with gene mutation in primary peritoneal carcinoma. 930 22

Upon activation, cell surface death receptors, Fas/APO-1/CD95 and tumor necrosis factor receptor-1 (TNFR-1), are attached to cytosolic adaptor proteins, which in turn recruit caspase-8 (MACH/FLICE/Mch5) to activate the interleukin-1 beta-converting enzyme (ICE)/CED-3 family protease (caspase) cascade. However, it remains unknown whether these apoptotic proteases are generally involved in apoptosis triggered by other stimuli such as Myc and p53. In this study, we provide lines of evidence that a death protease cascade consisting of caspases and serine proteases plays an essential role in Myc-mediated apoptosis. When Rat-1 fibroblasts stably expressing either s-Myc or c-Myc were induced to undergo apoptosis by serum deprivation, a caspase-3 (CPP32)-like protease activity that cleaves a specific peptide substrate, Ac-DEVD-MCA, appeared in the cell lysates. Induction of s-Myc- and c-Myc-mediated apoptotic cell death was effectively prevented by caspase inhibitors such as Z-Asp-CH2-DCB and Ac-DEVD-CHO. Furthermore, exposing the cells to a serine protease inhibitor, 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF), also significantly inhibited s-Myc- and c-Myc-mediated apoptosis and the appearance of the caspase-3-like protease activity in vivo. However, AEBSF did not directly inhibit caspase-3-like protease activity in the apoptotic cell lysates in vitro. Together, these results indicate that caspase-3-like proteases play a critical role in both s-Myc- and c-Myc-mediated apoptosis and that caspase-3-like proteases function downstream of the AEBSF-sensitive step in the signaling pathway of Myc-mediated apoptosis.
 ...
PMID:A functional role for death proteases in s-Myc- and c-Myc-mediated apoptosis. 934 38


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>