Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
 77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Previous studies have shown renal mesenchymal tumors (RMTs) induced in rats by a single intrarenal injection of nickel subsulfide and iron are more pleomorphic and metastatically aggressive than RMTs induced by a single ip injection of methyl(methoxymethyl)nitrosamine (DMN-OMe). While both RMT types contain high levels of K-ras activation, the specific mutational spectra within codon 12 of K-ras are quite different. Nickel subsulfide and iron-induced tumors exhibited codon 12 GGT-->GTT transversions exclusively, while DMN-OMe RMTs showed a wide array of codon 12 mutations, as well as mutations within codons 61 and 63 [K. G. Higinbotham, J. M. Rice, B. A. Diwan, K. S. Kasprzak, C. D. Reed, and A. O. Perantoni, Cancer Res., 52: 4747-4751, 1992; K. G. Higinbotham, J. M. Rice, and A. O. Perantoni, Mol. Carcinog., 5: 136-139, 1992]. In an effort to further correlate carcinogen-specific molecular events in renal tumors, we investigated the p53 tumor suppressor gene in RMTs induced by these two carcinogens for the presence of point mutations. The evolutionarily conserved portion of the coding region of the gene, including part of exon 4 through exon 10, was surveyed for point mutations utilizing single-strand conformation polymorphism and chemical cleavage of mismatches analyses. None (0 of 10) of the nickel subsulfide and iron-induced RMTs and only 1 of 10 DMN-OMe-induced tumors that were evaluated contained point mutations within this portion of the p53 gene. Direct sequencing of the one single-strand conformation polymorphism and chemical cleavage of mismatches-"positive" DMN-OMe-induced RMT revealed a GCC-->GTC (Ala-->Val) transition in codon 345 within exon 10. These results suggest that the different tumorigenic phenotypes exhibited by these two RMTs are not the result of specific mutations or patterns of mutations within the portion of the p53 gene examined and that the mutated p53 tumorigenic pathway, whereby p53 plays a major role in many human neoplasms, does not function in RMTs induced by either agent.
 ...
PMID:Low incidence of point mutations detected in the p53 tumor suppressor gene from chemically induced rat renal mesenchymal tumors. 826 41

The 55-kDa product of early region 1B (E1B) of human adenoviruses is required for viral replication and participates in cell transformation through complex formation with and inactivation of the cellular tumor suppressor p53. We have used both biochemical and genetic approaches to show that this 496-residue (496R) protein of adenovirus type 5 is phosphorylated at serine and threonine residues near the carboxy terminus within sequences characteristic of substrates of casein kinase II. Mutations which converted serines 490 and 491 to alanine residues decreased viral replication and greatly reduced the efficiency of transformation of primary baby rat kidney cells. Such mutant 496R proteins interacted with p53 at efficiencies similar to those of wild-type 496R but only partially inhibited p53 transactivation activity. These results indicated that phosphorylation at these carboxy-terminal sites either regulates the inhibition of p53 or regulates some other 496R function required for cell transformation.
 ...
PMID:Phosphorylation at the carboxy terminus of the 55-kilodalton adenovirus type 5 E1B protein regulates transforming activity. 828 81

The recent finding that eight out of 10 multiple myeloma cell lines have p53 gene mutations prompted us to examine the p53 tumour suppressor gene in 25 non-related multiple myeloma patients. None of 19 patient bone marrow samples available for Southern blot analysis showed rearrangements in the p53 gene and only one patient showed loss of the p53 locus. DNA encompassing exons 5, 7, and 8, where p53 mutations commonly cluster, was amplified by PCR. Single-strand conformation polymorphisms of the PCR-amplified exon 5 region were detected in two patients. Direct sequencing of the mutant band revealed that one patient had a C to T transition at codon 138 (Ala to Val) and one patient had a G to C transversion at codon 139 (Lys to Asn). p53 mutations in germline cells in hereditary cancer syndromes predispose the family members to the development of malignancies. We therefore searched for p53 germline mutations in exons 5, 7, and 8 in the affected individuals from three families each with two multiple myeloma patients (these patients include three individuals from the non-related group mentioned above). Using Southern blotting, polymerase chain reaction/single-strand conformation polymorphism (PCR-SSCP) analysis and direct sequencing, no germline mutations were found. These results indicate that mutations in exons 5, 7, and 8 of the p53 gene are infrequent in multiple myeloma.
 ...
PMID:Sporadic mutations of the p53 gene in multiple myeloma and no evidence for germline mutations in three familial multiple myeloma pedigrees. 832 Oct 49

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.
 ...
PMID:Novel DNA binding of p53 mutants and their role in transcriptional activation. 836 64

Human hepatocellular carcinoma (HCC) often contains intratumoral subpopulations of heterogeneous cellular differentiations within each tumor. To analyze the genetic alterations of p53 in the heterogeneous subpopulations, we examined 68 intratumoral nodular lesions within 34 HCCs composed of two distinct subpopulations. The cellular differentiations were determined histologically by Edmondson's grading system. Nine (26.5%) of 34 HCCs examined were found to have genetic alterations in exons 5 to 8 of the p53 gene, resulting in amino acid substitutions. Three of these nine HCCs with p53 mutations showed genetic heterogeneity of the p53 gene within each tumor; one HCC had a single missense mutation at codon 210 (asparginine to 210-serine) in an intratumoral lesion of Edmondson Grade II and double missense mutations at codons 210 and 217 (asparginine to 210-serine and valine to 217-alanine) in another intratumoral lesion of Edmondson Grade III. The remaining two HCCs had p53 mutations only in lesions of a higher grade. In total, the p53 mutations were detected in none of eight Edmondson Grade I lesions, in five of 29 Grade III lesions (17.2%), in eight of 26 Grade III lesions (30.8%), and in three of five Grade IV lesions (60.0%). Thus, our data revealed that the p53 mutations were closely related to the progression of HCC and that, in certain cases, malignant cells which acquired the p53 mutations might develop into dedifferentiated subpopulations within individual HCC.
 ...
PMID:Tumor progression in hepatocellular carcinoma may be mediated by p53 mutation. 838 46

A G:C-->T:A mutational hotspot at codon 249 of the p53 tumor suppressor gene has previously been identified in hepatocellular carcinoma (HCC) of patients from Qidong, China and southern Africa in which aflatoxin B1 (AFB1) and hepatitis B virus (HBV) are known synergistic risk factors. We have examined p53 mutation patterns of HCC from geographic areas in which the risk factors vary. Nine HCC lines and four hepatoblastoma lines (HB) were examined for p53 gene mutations and the relationship with HBV infection. Five of the nine HCC lines had homozygous mutation or deletion randomly distributed in exons 6-8, whereas none of the four HB cell lines had p53 mutations. One of the four HB lines (HepG2) had an N-ras mutation at codon 61 position 2. The p53 point mutations in the three HCC cell lines from Japan resulted in the amino acid changes of cysteine for tyrosine in cell line HuH 7 at codon 220 (A:T-->G:C), alanine for glycine in cell line HLF at codon 244 (G:C-->C:G), and serine for arginine in cell line HLE at codon 249 (G:C-->C:G). In addition, the deletion of 18 base pairs from codon 264 position 3 to codon 270 position 1 has resulted in the deletion of Leu-Gly-Arg-Asn-Ser-Phe from the amino acids sequences 256-270 in the Japanese cell line HuH 4. The cell line PLC/PRF/5 that showed p53 mutation at codon 249 (G:C-->T:A) with substitution of serine for arginine was derived from a South African patient. Our results indicate that whereas the p53 gene is not mutated in the HB cell lines, the HCC cell lines frequently contain an abnormal p53 gene. In addition, p53 point mutations were not detected in the four Japanese HCC cell lines that were positive for genomic integration of HBV X-gene and surface antigen gene. The three Japanese HCC cell lines with p53 mutations did not contain HBV sequences, indicating that hepatocarcinogenesis associated with p53 mutation does not require the genomic integration of HBV sequences.
 ...
PMID:p53 gene mutation and integrated hepatitis B viral DNA sequences in human liver cancer cell lines. 838 56

Overexpression of wild-type p53 prevents cells from entering the S phase of the cell cycle. The amino-terminal transactivation region of p53 is phosphorylated by several protein kinases, including DNA-PK, a nuclear serine/threonine protein kinase that in vitro requires DNA for activity. DNA-PK was recently shown to phosphorylate serines 15 and 37 of human p53 (Lees-Miller et al., 1992. Mol. Cell. Biol., 12, 5041-5049). To prevent phosphorylation at these sites, mutants were constructed that changed the codons for serine 15 or serine 37 to alanine codons. Expression of p53-Ala-37 in stably transformed T98G cells blocked progression of the cells into S phase as well as did the expression of wild-type p53. In contrast, p53-Ala-15 was partially defective in blocking cell cycle progression. Several cell clones transformed with the mutant p53-Ala-15 gene expressed normal levels of p53 mRNA but accumulated little or no detectable p53 protein. However, by using a transient expression system driven by a strong cytomegalovirus promoter, we showed that the inability of p53-Ala-15 to fully block cell cycle progression was not due to inadequate levels of expression or to a failure of the mutant protein to accumulate in the nucleus. These results suggest that phosphorylation of Ser-15 may affect p53 function.
 ...
PMID:Mutation of the serine 15 phosphorylation site of human p53 reduces the ability of p53 to inhibit cell cycle progression. 850 77

HL60 cells, which lack the p53 gene due to a deletion, were used as an in vitro model system to study the effect of wild-type p53 gene expression on hematopoietic differentiation. We transfected HL60 cells with wild-type p53 and two mutant p53 cDNAs encoding the Val to Ala mutation at codon 143 and the Arg to Trp mutation at codon 248. Flow cytometry, growth, and cytochemical analysis for alpha-napthyl butyrate esterase activity and nitroblue tetrazolium reduction indicated that wild-type p53 but not mutant p53 induced early monocytic differentiation in the transfected HL60 cells without terminal growth arrest. The wild-type p53 transfectants did not differentiate along the granulocytic pathway, even when induced with 1.25% DMSO for 6 days; rather, these cells resembled monocytic cells, confirming that wild-type p53 transfection caused these cells to become committed to differentiate along the monocytic pathway. HL60 cells transfected with wild-type p53 were more sensitive to stress, such as growth in serum-depleted medium and exposure to a chemotherapeutic agent, etoposide.
 ...
PMID:Transfection of wild-type but not mutant p53 induces early monocytic differentiation in HL60 cells and increases their sensitivity to stress. 856 79

The effects of exogenous human p53 and its various mutants (Ala-141, His-175, His-194, Trp-248, His-273) on two key enzymes of purine uptake, adenosine deaminase (AD) and hypoxanthine phosphoribosyl transferase (HPRT), has been studied in Rat 1 immortalized fibroblasts and their sublines transformed by N-RAS or v-mos oncogenes. Introduction into Rat1 cells of both wild type (wt) and mutant p53 produced a 2- to 7.5-fold increase in the AD activity, p53 mutants having a stronger effect than p53wt. In contrast, the HPRT activity decreased 8- to 10-fold in cells containing exogenous p53wt, while p53 mutants partly lost their ability to inhibit HPRT. Transformation of Rat1 by ras or mos oncogenes was also accompanied by an increase in the AD activity (4-5-fold and 1.5-2-fold, respectively) as well as by suppression of HPRT (20-fold and 2-fold, respectively). However, simultaneous expression of exogenous p53 and ras or p53 and mos produced opposite effects, i.e., a dramatic decrease in the AD activity and complete (p53wt, His-273) or partial (His-175, Trp-248) restoration of the HPRT activity. Possible functional significance and mechanisms of AD and HPRT regulation by p53 as well as the role of modifications of activity of nucleotide synthesis enzymes in the cooperative effect of predominant oncogenes and mutant p53 oncogenes in tumour transformation are discussed.
 ...
PMID:[Opposite effect of p53 on nucleotide metabolizing enzyme activity in Rat1 cells and their sublines, transformed by N-RAS or v-mos oncogenes]. 859 Jul 59

The p53 tumour suppressor protein is a potent transcription factor which plays a central role in the defence of cells against DNA damage and the propagation of malignant clones. We have previously shown that phosphorylation of serine 386 in mouse p53 by the growth- associated protein kinase, casein kinase II (CKII), plays an important role in the ability of p53 to block the proliferation of drug-resistant colonies. In this paper we show that blocking phosphorylation of serine 386 through an alanine substitution, or placing a constitutive negative charge at this position in the form of aspartate, had no significant influence on p53-dependent transcriptional activation of a promoter containing 13 copies of a p53 consensus binding sequence, or of the p21WAF1 promoter which is a natural target for p53. In contrast, the alanine mutant showed a weak reduction in the ability of p53 to repress expression from the c-fos promoter, which is a target for p53-dependent repression in vivo. Strikingly, when the repression of the SV40 early promoter was examined, a reduction in the repression capacity of up to 5-fold was observed. Moreover, repression of the SV40 promoter could be partially restored by aspartic acid substitution at the phosphorylation site. These data indicate that phosphorylation at a specific C-terminal site can selectively regulate p53-dependent repression, but not transactivation.
 ...
PMID:Phosphorylation of p53 at the casein kinase II site selectively regulates p53-dependent transcriptional repression but not transactivation. 860 47


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>