Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

An in vitro model system for xenogenization has been developed in which an immunogenic, nonmalignant phenotype was selected from a highly malignant T-cell line (S49). We showed by single-strand conformation polymorphism and DNA sequence analysis that specific point mutations in the p53 tumor suppressor gene correlated with a change from a tumorigenic to a nontumorigenic (immunogenic) phenotype. Specifically, we found that the highly malignant S49 cell line T-60 contains an Arg-->Gln substitution at residue 246 in exon 7 of p53. In contrast, nontumorigenic (immunogenic) variants (T-25-Adh and Rev-1) exhibited a Gly-->Ser substitution at residue 242 of p53. In two subsequent tumorigenic revertants derived from Rev-1, we again found the Arg-->Gln substitution at residue 246 that was found initially in the T-60 cells. Thus, mutation at residue 246 of p53 was associated with a highly malignant phenotype, whereas a novel mutation at residue 242 of p53 appeared to be associated with a nonmalignant phenotype and may have actually protected the host through immunization. We conclude that mutation of residue 242 may represent a new class of permissive (nonmalignant) mutations in the mouse that are analogous to the Li-Fraumeni mutation in humans.
...
PMID:Association of tumorigenic and nontumorigenic (immunogenic) variants in a mouse T-cell lymphoma with two distinct p53 mutations. 828 Mar 70

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.
...
PMID:Novel DNA binding of p53 mutants and their role in transcriptional activation. 836 64

A G:C-->T:A mutational hotspot at codon 249 of the p53 tumor suppressor gene has previously been identified in hepatocellular carcinoma (HCC) of patients from Qidong, China and southern Africa in which aflatoxin B1 (AFB1) and hepatitis B virus (HBV) are known synergistic risk factors. We have examined p53 mutation patterns of HCC from geographic areas in which the risk factors vary. Nine HCC lines and four hepatoblastoma lines (HB) were examined for p53 gene mutations and the relationship with HBV infection. Five of the nine HCC lines had homozygous mutation or deletion randomly distributed in exons 6-8, whereas none of the four HB cell lines had p53 mutations. One of the four HB lines (HepG2) had an N-ras mutation at codon 61 position 2. The p53 point mutations in the three HCC cell lines from Japan resulted in the amino acid changes of cysteine for tyrosine in cell line HuH 7 at codon 220 (A:T-->G:C), alanine for glycine in cell line HLF at codon 244 (G:C-->C:G), and serine for arginine in cell line HLE at codon 249 (G:C-->C:G). In addition, the deletion of 18 base pairs from codon 264 position 3 to codon 270 position 1 has resulted in the deletion of Leu-Gly-Arg-Asn-Ser-Phe from the amino acids sequences 256-270 in the Japanese cell line HuH 4. The cell line PLC/PRF/5 that showed p53 mutation at codon 249 (G:C-->T:A) with substitution of serine for arginine was derived from a South African patient. Our results indicate that whereas the p53 gene is not mutated in the HB cell lines, the HCC cell lines frequently contain an abnormal p53 gene. In addition, p53 point mutations were not detected in the four Japanese HCC cell lines that were positive for genomic integration of HBV X-gene and surface antigen gene. The three Japanese HCC cell lines with p53 mutations did not contain HBV sequences, indicating that hepatocarcinogenesis associated with p53 mutation does not require the genomic integration of HBV sequences.
...
PMID:p53 gene mutation and integrated hepatitis B viral DNA sequences in human liver cancer cell lines. 838 56

The 289-residue (289R) and 243R early region 1A (E1A) proteins of human adenovirus type 5 induce cell transformation in cooperation with either E1B or activated ras. Here we report that Ser-132 in both E1A products is a site of phosphorylation in vivo and is the only site phosphorylated in vitro by purified casein kinase II. Ser-132 is located in conserved region 2 near the primary binding site for the pRB tumor suppressor and, in 289R, just upstream of the conserved region 3 transactivation domain involved in regulation of early viral gene expression. Mutants containing alanine or glycine in place of Ser-132 interacted with pRB-related proteins at somewhat reduced efficiency; however, all Ser-132 mutants transformed primary rat cells in cooperation with E1B as well as or better than the wild type when both major E1A proteins were expressed. Such was not the case with mutants expressing only 289R. In cooperation with E1B, the Asp-132 and Gly-132 mutants yielded reduced numbers of smaller transformed foci. With activated ras, all Ser-132 mutants were significantly defective for transformation and the rare foci produced were small and contained extensive areas populated by low densities of flat cells. In the absence of E1B, all Ser-132 mutants induced p53-independent cell death more readily than virus expressing wild-type 289R. These results suggested that phosphorylation at Ser-132 may enhance the binding of pRB and related proteins and also reduce the toxicity of E1A 289R, thus increasing transforming activity.
...
PMID:Importance of the Ser-132 phosphorylation site in cell transformation and apoptosis induced by the adenovirus type 5 E1A protein. 876 48

Aberrations of the p53 and Rb tumour suppressor genes were examined in 12 human hepatocellular carcinoma (HCC)-derived cell lines from different geographic areas and 9 local HCCs by restriction fragment length polymorphisms (RFLP), polymerase chain reaction-single-strand conformation polymorphisms (PCR-SSCP) and DNA sequencing. The relationships between genetic changes and hepatitis B virus (HBV) DNA integration in samples were compared. None of the cell lines and tumours showed structural changes in the Rb gene, while 6 cell lines and 2 tumours had mutation or deletion in exons 5 to 8 of p53. Mutations include an AGG --> AGT (Arg --> Ser) transversion at codon 249 in PLC/PRF/5 and Mahlavu, an AAT --> AAA (Asn --> Cys) transversion at codon 200 in TONG/HCC, an AAG --> GAG (Lys --> Glu) transition at codon 139 in HCC-T, a CAT --> CGT (His --> Arg) transition at codon 214 in SC4, and a CCC --> CTC (Pro --> Leu) transition at codon 250 in SC8. In Huh4, an 18-bp deletion from codon 264 to 270 resulted in loss of Leu-Gly-Arg-Asn-Ser-Phe from the amino acid sequences 265 to 270, whereas Hep3B had a 7-kb deletion after exon 7 of p53. Our data indicate that whereas Rb may not have pleiotropic effects on HCC, p53 aberrations are frequently involved in hepatocarcinogenesis. Further, HBV infection appears to be unrelated to the micro-genetic changes of p53. The G to T codon-249-mutation is consistent with HCCs arising from areas at high risk for both aflatoxin B1 (AFB1) exposure and HBV infection.
...
PMID:Tumour suppressor p53 and Rb genes in human hepatocellular carcinoma. 877 41

To determine whether p53 alterations, which are frequent in human breast cancers, are also common in rat mammary tumors, we examined 40 tumors from 24 rats treated with 7,12-dimethylbenz[a]anthracene (DMBA) and 34 tumors from 14 rats treated with N-nitroso-N-methylurea (NMU) (an N-nitroso compound). DMBA and NMU are known genotoxic mutagens. The entire coding regions of the p53 and Ha-ras genes were examined for mutations by polymerase chain reaction single-strand conformational polymorphism analysis and by direct sequencing. One of the 40 DMBA-induced mammary tumors had a p53 mutation, a single-base substitution (AGC-->GGC) at codon 307, resulting in an amino-acid change from Ser to Gly. No mutations were found in NMU-induced tumors. The incidence of Ha-ras gene mutation was 79% (27 of 34) at codon 12 in the NMU group and 23% (nine of 40) at codon 61 in the DMBA group. Thus, p53 mutation, in contrast to Ha-ras mutation, did not seem to be a prerequisite for carcinogenesis in chemically induced rat mammary tumors.
...
PMID:Incidence of p53 and Ha-ras gene mutations in chemically induced rat mammary carcinomas. 889 Sep 56

The postnatal development of spontaneous GABAergic transmission between cerebellar Golgi cells and granule cells was investigated with voltage-clamp recording from rat cerebellar slices, in symmetrical Cl- conditions. Between postnatal days 7 and 14 (P7-14), bicuculline- and TTX (tetrodotoxin)-sensitive spontaneous inhibitory postsynaptic currents (sIPSCs), occurred at high frequency in 56% of granule cells. Between P10 and P14, sIPSCs were superimposed on a tonic current of -12 +/- 1.8 pA at -70 mV, that was accompanied by noise with a variance of 17 +/- 3 pA2. Both the current and noise were inhibited by bicuculline. TTX blocked the bicuculline-sensitive current and noise by approximately 60%. Between P18 and P25, sIPSCs were less frequent; all cells showed tonic, bicuculline-sensitive currents, but these were partially inhibited by TTX (approximately 35%). Between P40 and P53, sIPSCs were rare; tonic, bicuculline-sensitive currents and noise were greater in amplitude, with mean values of -17 pA and 22 pA2 at -70 mV, they were present in all cells but they were not inhibited by TTX. Glycine receptor channels that were expressed in immature, but not adult cells, did not mediate spontaneous currents. Our results indicate that spontaneous transmission onto cerebellar granule cells in immature animals consists primarily of action potential-dependent, phasic release of vesicular GABA. This generates GABAA receptor-mediated sIPSCs. The effects of GABA transporter blockers suggest that it also produces the TTX-sensitive current-noise, as GABA spills out of synapses to activate extrasynaptic receptors or receptors in neighbouring synapses. In older animals, action potential-independent release of transmitter is predominant and results in tonic activation of GABAA receptors. This does not appear to be spontaneous vesicular release of GABA. Neither does it appear to be reversed uptake of GABA, although further work is required to rule out these possibilities.
...
PMID:Development of action potential-dependent and independent spontaneous GABAA receptor-mediated currents in granule cells of postnatal rat cerebellum. 910 95

The p21WAF1/CIP1 gene is regulated by p53 and encodes a cyclin-dependent kinase (Cdk)-inhibitor involved in senescence and cell quiescence. The role of p21 as a negative regulator of cell proliferation suggests that it may function as a tumor suppressor gene. However, only a few mutations of the p21WAF1/CIP1 gene have been reported to date. In order to assess potential p21WAF1/CIP1 gene alterations in human bladder cancer, we have examined this gene and its encoded product in a well-characterized cohort of 27 primary bladder tumors. Mobility shifts by single-strand conformation polymorphism in the p21WAF1/CIP1 gene were identified in 2 cases. Sequencing analyses revealed that one of these cases had point mutations in the 3' untranslated region, while the other case had a frame shift mutation at positions 322 (C to A) and a deletion of 8 nucleotides (323-->331; CCG-->ACG, codon 81 Arg-->Thr) that produced a stop signal at codon 83 (Gly--Stop). This tumor had a p21-negative phenotype by immunohistochemistry, but did not lose any allele. We further characterized these cases by the study of TP53 mutations using single-strand conformation polymorphism (PCR-SSCP) and sequencing, as well as immunohistochemical assays. Seven mobility shifts were identified and seven cases showed p53 nuclear accumulation. The two cases displaying mutated p21WAF1/CIP1 had wild-type TP53. It is concluded that p21WAF1/CIP1 gene aberrations are infrequent in bladder carcinoma but may be occasionally identified in primary bladder tumors.
...
PMID:Analysis of p21WAF1/CIP1 in primary bladder tumors. 911 33

We analyzed p53 mutations in 17 N-butyl-N-(4-hydroxybutyl) nitrosamine-induced bladder transitional cell carcinomas (TCCs) with or without areas of squamous cell carcinoma (SCC) of Long-Evans Cinnamon (LEC) and F344 rats, and in 7 N-methyl-N-nitrosourea-induced colon adenocarcinomas of LEC rats by polymerase chain reaction-single strand conformation polymorphism analysis and DNA sequencing. Of these bladder tumors, one TCC with moderately differentiated SCC had a T to G transversion mutation at codon 141, leading to a Val to Gly amino acid change. No p53 mutation was found in colon adenocarcinomas. Thus a p53 gene mutation seems infrequent in these rat bladder and colon carcinogenesis models even in the late stage.
...
PMID:p53 gene mutation in N-butyl-N-(4-hydroxybutyl)nitrosamine-induced urinary bladder tumors and N-methyl-N-nitrosourea-induced colon tumors of rats. 923 35

Human colorectal tumor cell lines were established which express wildtype p21 or p21 with a mutation at codon 46 (Cys) or 140 (Gly) on IPTG treatment (LacSwitch). The IPTG-induced wildtype p21 bound to CDK2 and PCNA and inhibited CDK activity in the cells and reduced cell growth rate; whereas, both IPTG-induced mutated p21 proteins neither bound to CDK2 nor affected the CDK activity but did bind to PCNA, and they did not affect the cell growth rate. Wildtype p21 suppressed apoptosis and enhanced survival of X-ray-irradiated or adriamycin-treated cells; but, mutated p21 neither suppressed apoptosis nor affected cell survival. When cells were treated with mimosine, a p53-independent p21-inducer, or butyrolactone I, a specific inhibitor of CDK, cellular endogenous p21 was induced and X-ray or adriamycin-induced apoptosis was blocked. These results suggest that CDK-binding or CDK-inhibitory activity of p21 is required to prevent apoptosis, i.e., CDK is required for apoptosis in human tumor cells.
...
PMID:Mutated p21(WAF1/CIP1/SDI1) lacking CDK-inhibitory activity fails to prevent apoptosis in human colorectal carcinoma cells. 948 34


<< Previous 1 2 3 4 5 6 7 8 Next >>