Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P04637 (
p53
)
77,613
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
In cells transformed by mutant mouse
p53
plus ras, the former protein is found to be complexed with the heat-shock protein cognate hsc70. To determine whether hsc70 can directly affect neoplastic transformation, nonestablished rat embryo fibroblasts (REF) were transfected with rat genomic hsc70 DNA in conjunction with various oncogenes. We report here that the hsc70 gene could efficiently suppress focus induction by mutant p53 plus ras, as well as by myc plus ras. No inhibitory effect of hsc70 was detectable in assays monitoring the ability of REF to be immortalized by mutant p53, arguing against a nonspecific deleterious effect of the hsc70 genomic clone on REF survival and proliferation. Lines generated in the presence of the hsc70 plasmid produced augmented levels of hsc70. Plasmids encoding only short
NH2
-terminal fragments of hsc70 could also, in some cases, partially reduce oncogene-mediated focus formation. However, a maximal inhibitory effect required the production of a functional hsc70 protein. The data presented here raise the possibility that hsc70 may be directly involved in the modulation of oncogene-mediated transformation.
...
PMID:The gene for the rat heat-shock cognate, hsc70, can suppress oncogene-mediated transformation. 146 7
The cellular proteins that interact with simian virus 40 large T antigen (T-ag) must be identified in order to understand T-ag effects on cellular growth control mechanisms. A protein extraction procedure utilizing single-phase concentrations of 1-butanol recovered a complex composed of T-ag,
p53
, and other Mr 35,000-60,000 proteins from suspension cultures of the simian virus 40-transformed mouse cell line mKSA. Partial protease mapping showed each of the associated proteins to be unique. Automated microsequence analysis of the
NH2
-terminal 30 amino acids of the Mr 56,000 protein purified after coprecipitating with T-ag and
p53
identified it as the beta subunit of mouse tubulin. The existence of a complex containing tubulin, T-ag, and
p53
was confirmed by reciprocal immunoblotting experiments. Both T-ag and
p53
were coprecipitated by three different monoclonal antibodies directed against tubulin, and conversely, monoclonal antibodies specific for T-ag or
p53
coprecipitated tubulin. Mixing experiments and extractions in the presence of purified tubulin indicated that the complex existed in situ prior to cell lysis. Both
p53
and T-ag copurified with microtubules through two cycles of temperature-dependent disassembly and assembly. Both T-ag and
p53
were localized to microtubules in the cytoplasm of mKSA cells by immunoelectron microscopy. Treatment of mKSA cells with 10 microM colchicine followed by lysis in 0.1% Nonidet P-40 resulted in increased amounts of solubilized T-ag and
p53
. Both T-ag and
p53
were also associated with microtubules in three other simian virus 40-transformed mouse cell lines growing as monolayers, confirming the generality of the association. An interaction of T-ag and
p53
with microtubules may be important in the intracellular transport of these proteins and may affect cellular signal transduction or growth control.
...
PMID:Simian virus 40 large T antigen and p53 are microtubule-associated proteins in transformed cells. 164 52
Synthetic peptide substrates for the cell division cycle regulated protein kinase, p34cdc2, have been developed and characterized. These peptides are based on the sequences of two known substrates of the enzyme, Simian Virus 40 Large T antigen and the human cellular recessive oncogene product,
p53
. The peptide sequences are H-A-D-A-Q-H-A-T-P-P-K-K-K-R-K-V-E-D-P-K-D-F-OH (T antigen) and H-K-R-A-L-P-N-N-T-S-S-S-P-Q-P-K-K-K-P-L-D-G-E-Y-
NH2
(
p53
), and they have been employed in a rapid assay of phosphorylation in vitro. Both peptides show linear kinetics and an apparent Km of 74 and 120 microM, respectively, for the purified human enzyme. The T antigen peptide is specifically phosphorylated by p34cdc2 and not by seven other protein serine/threonine kinases, chosen because they represent major classes of such enzymes. The peptides have been used in whole cell lysates to detect protein kinase activity, and the cell cycle variation of this activity is comparable to that measured with specific immune and affinity complexes of p34cdc2. In addition, the peptide phosphorylation detected in mitotic cells is depleted by affinity adsorption of p34cdc2 using either antibodies to p34cdc2 or by immobilized p13, a p34cdc2-binding protein. Purification of peptide kinase activity from mitotic HeLa cells yields an enzyme indistinguishable from p34cdc2. These peptides should be useful in the investigation of p34cdc2 protein kinase and their regulation throughout the cell division cycle.
...
PMID:Characterization of synthetic peptide substrates for p34cdc2 protein kinase. 204 31
The
p53
gene is frequently mutated in a wide variety of human cancers. However, the role of the wild-type
p53
gene in growth control is not known. Hybrid proteins that contain the DNA binding domain of yeast GAL4 and portions of
p53
have been used to show that the
p53 protein
contains a transcription-activating sequence that functions in both yeast and mammalian cells. The
NH2
-terminal 73 residues of
p53
activated transcription in mammalian cells as efficiently as the herpes virus protein VP16, which contains one of the strongest known activation domains. Combined with previous data that showed
p53
is localized to the nucleus and can bind to DNA, these results support the idea that one function of
p53
is to activate the transcription of genes that suppress cell proliferation.
...
PMID:Presence of a potent transcription activating sequence in the p53 protein. 214 63
The interaction of alpha-thrombin with the hirudin (HV1) fragment N alpha-acetyl desulfo hirudin45-65 (P51) was investigated. Kinetic analysis revealed that P51 inhibits the proteolysis of a tripeptidyl substrate with Ki = 0.72 +/- 0.13 and 0.11 +/- 0.03 microM for bovine and human alpha-thrombins, respectively. The inhibition was partially competitive, affecting substrate binding to the enzyme-inhibitor complex by a factor alpha = 2 (bovine) and alpha = 4 (human) characteristic of hyperbolic inhibitors. P51 also inhibited thrombin-induced fibrin clot formation with IC50 values of 0.94 +/- 0.20 and 0.058 +/- 0.006 microM for bovine and human alpha-thrombins, respectively. The enhanced antithrombin activity for human thrombin could be attributed to species variations in the putative auxiliary "anion" exosite since N alpha-acetyl desulfo hirudin55-65 displayed the same rank order of potency shift in a clotting assay without inhibiting the amidolytic activity of either enzyme. From these observations, a potent thrombin inhibitor was designed having modified residues corresponding to the P1 and P3 recognition sites. N alpha-Acetyl[D-Phe45, Arg47] hirudin45-65 (
P53
) emerged as a pure competitive inhibitor with a Ki = 2.8 +/- 0.9 nM and IC50 = 4.0 +/- 0.8 nM (human alpha-thrombin) and is designated as a "bifunctional" inhibitor. Its enhanced potency could be explained by a cooperative intramolecular interaction between the COOH-terminal domain of the inhibitor and the auxiliary exosite of thrombin on the one hand, and the modified
NH2
-terminal residues with the catalytic site on the other.
...
PMID:Bifunctional thrombin inhibitors based on the sequence of hirudin45-65. 225 23
The subnuclear distribution of simian virus 40 large T antigen within nuclei of transformed Cos and C6 monkey cells was examined. Cos cells express wild-type T antigen but lack viral sequences required for DNA replication, whereas C6 cells contain a functional viral origin but express a replication-defective mutant T antigen which is unable to bind specifically to viral DNA. Discrete subpopulations of T antigen were isolated from the soluble nucleoplasm, chromatin, and nuclear matrix of both cell lines. Although only a small quantity (2 to 12%) of the total nuclear T antigen from Cos cells was associated with the nuclear matrix, a high proportion (25 to 50%) of C6 T antigen was bound to this structure. Results obtained from lytically infected monkey cells showed that early in infection, before viral replication was initiated, a higher proportion (22%) of T antigen was found associated with the nuclear matrix compared with amounts found associated with this structure later in infection (5 to 8%). These results suggest that an increased association of T antigen with this structure is not correlated with viral replication. T antigen isolated from the C6 nuclear matrix was more highly phosphorylated than was soluble C6 T antigen and was capable of binding to the host
p53 protein
. C6 DNA contains three mutations: two corresponding to N-terminal changes at amino acid positions 30 and 51 and a third located internally at amino acid position 153. By analysis of the subnuclear distribution of T antigen from rat cells transformed by C6 submutant T antigens, it was determined that one or both of the mutations at the
NH2
terminus are responsible for the increased quantity of C6 T antigen associated with the nuclear matrix. These results suggest that neither a functional viral DNA replication origin nor the origin binding property of T antigen is required for association of this protein with the nuclear matrix.
...
PMID:Association of simian virus 40 T antigen with the nuclear matrix of infected and transformed monkey cells. 609 67
A c-DNA clone containing the complete sequence information for the murine
p53 protein
, from embryonal carcinoma cells, has been isolated. The nucleotide sequence of this clone reveals an open reading frame encoding a protein of 390 amino acids with a molecular weight of 43,364 Da. The
NH2
-terminal domain of this protein is acidic whereas the carboxyl terminus is rich in basic amino acid residues. These terminal domains are separated by a proline-rich, hydrophobic run of amino acids. Proline comprises approximately 10% of the total amino acid residues. Two tryptic peptides, derived from
p53 protein
radiolabeled with either methionine or proline, were purified and the position of these labeled residues in the peptide was determined. The positions of three methionine and five proline residues in these two peptides matched the amino acid sequence of the predicted open reading frame determined from the c-DNA clone.
...
PMID:The amino acid sequence of murine p53 determined from a c-DNA clone. 640 59
Active, recombinant p68 reverse transcriptase (RT) from human immunodeficiency virus type 2 (HIV-2), with an
NH2
-terminal extension containing a hexahistidine sequence was isolated from extracts of Escherichia coli by immobilized metal affinity chromatography. Treatment of the purified p68/p68 homodimer of HIV-2 RT with recombinant HIV-2 protease generates stable, active heterodimer (p68/p58) that is resistant to further hydrolysis. Analysis of this p68/p58 HIV-2 RT heterodimer revealed that while one subunit is intact p68, the p58 subunit is COOH-terminally truncated by cleavage, not at Phe440 as is seen in processing of the p66/p66 HIV-1 RT homodimer by HIV-1 protease, but at Met484. The expected COOH-terminal p10 fragment resulting from hydrolysis of p68 at Met484 is not released intact, but undergoes further cleavage at Asn494, Met503, and Tyr532. Processing of p68/p68 HIV-2 RT with the HIV-1 protease led to cleavage of the Phe440-Tyr441 bond, exactly as is seen with p66/p66 HIV-1 RT, to give the analogous
p53
subunit. Studies of a peptide substrate modeled after residues 437-444 in HIV-2 RT showed that while the HIV-1 protease was able to cleave the Phe440 bond, this bond was resistant to cleavage by the HIV-2 enzyme. Our findings provide a rationale for the previous observation that the RT heterodimer isolated from HIV-2 lysates is larger than that from HIV-1. We conclude that the p68/p58 HIV-2 RT heterodimer, containing the Met484 truncated p58 subunit, is a biologically relevant form of the enzyme in vivo.
...
PMID:The differential processing of homodimers of reverse transcriptases from human immunodeficiency viruses type 1 and 2 is a consequence of the distinct specificities of the viral proteases. 753 31
Murine
tumor suppressor p53
is phosphorylated in the
NH2
-terminal transactivating domain at serines 9, 18, and 37. Change of any one of these serines to either alanine or aspartic acid did not alter
p53
suppression of transformation of rat embryo fibroblasts by activated ras and E1A. Change of any two of these serines to alanines, however, led to a significant decrease in suppressor function. Substitution of alanines for all three serines caused the most severe loss of suppression and also reduced transactivation functions. The triple substitution had no apparent effects on intracellular accumulation or localization of
p53
, oligomerization, DNA binding, or interaction with the TFIID TATA-binding protein. In contrast, triple substitution of aspartic acid for serines 9, 18, and 37 had minimal effects on suppression and transactivation by
p53
. These results argue strongly that phosphorylation of serines 9, 18, and 37 facilitates the suppression and transactivation functions of
p53
.
...
PMID:Serine phosphorylation in the NH2 terminus of p53 facilitates transactivation. 775 94
Normal
p53 protein
suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of
p53
decrease its antiproliferation function. In this work, we studied the requirement of the
NH2
- and COOH-terminal regions of
p53
in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the
NH2
-terminus and deletion of 67 amino acids from the COOH-terminus of
p53
drastically reduced the antiproliferation function of
p53
. However, the COOH-terminal deletion mutant is capable of binding to a
p53
DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that
p53
' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.
...
PMID:The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function. 794 85
1
2
3
4
5
6
7
8
9
10
Next >>