Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
 77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Myelodysplastic syndromes originate from a pluripotent stem cell. This view, previously suggested by G-6-PD and cytogenetic investigations, has been established unequivocally by X-chromosome inactivation analysis based on DNA polymorphisms and by studies of mutated oncogenes. Two genomic alterations associated with MDS have been analyzed in more detail. Activation of the RAS oncogenes, preferentially N-RAS, is demonstrated in approximately 35% of MDS patients. Mutations in the FMS gene, encoding the CSF-1 receptor, are found in 16% of cases. Interestingly, RAS and FMS mutations are predominantly observed in disorders of myelomonoctic differentiation, i.e., the CMML subtype in MDS and the AML FAB type M4. Moreover, homozygous deletion of the FMS gene may be an important event in the genesis of the MDS variant 5q- syndrome. Preliminary data indicate that defects in tumor-suppressor genes, namely p53, may also contribute to the development of MDS. Different lines of evidence suggest that clinical preleukemia is preceded by a phase in which genetic alterations accumulate without any hematologic change. Cases in point are the detection of RAS and FMS mutations in healthy individuals who had been treated in the past with cytotoxic therapy for lymphoma, the frequent observation of clonal remission in AML patients, or the identification of oncogene mutations in healthy individuals without even a history of malignancy or chemotherapy. Possibly, either germline mutations of oncogenes or tumor-suppressor genes and the process of genomic imprinting may constitute additional factors that predispose hematopoietic stem cells to malignant transformation. Limited as they are, the currently available data suggest that accumulation of genomic lesions, rather than their precise order of development with respect to one another, characterize the multistep process of leukemogenesis in which MDS already represent more advanced stages. The prognostic significance of oncogene mutations in MDS patients is controversially discussed. This issue awaits prospective analyses taking into account the influence of treatment modalities. However, the clinical relevance of molecularly defined parameters has already been established for their use as clonal markers in determining the mode of action and efficiency of different therapeutic approaches.
 ...
PMID:Molecular genetic aspects of myelodysplastic syndromes. 161 6

We performed Southern blot analysis of the p53 gene in 62 patients (37 de novo myelodysplastic syndromes (MDS), of which 10 were studied after progression to acute myeloid leukemia (AML); 14 MDS secondary to chemo or radiotherapy; 11 de novo AML). Thirteen of the 56 patients studied cytogenetically had monosomy for the short arm of chromosome 17 and, in another patient who had secondary MDS, a translocation involving a breakpoint in 17p13 where the p53 gene was mapped was found. This patient was the only individual in whom a rearrangement of p53 DNA was seen. Sixteen of the 62 patients were studied by Northern analysis, and reduced or undetectable 2.8 kb p53 transcript was found in 6 of them, who had predominantly monosomy for 17p or chronic myelomonocytic leukemia. Rearrangements of the 53 gene, identifiable by Southern analysis, are a rare finding in patients with MDS and AML, even in those with monosomy for 17p, but reduced expression of the p53 gene is relatively common. We are currently trying to detect point mutations of the p53 gene by PCR technology especially in patients with monosomy for 17p.
 ...
PMID:Rearrangement and expression of the p53 gene in myelodysplastic syndrome and acute myeloid leukemia. 209 8

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.
 ...
PMID:Structure and chromosomal assignment of the human cyclin G gene. 895 86

The molecular mechanisms underlying the development and evolution of myelodysplastic syndrome (MDS) are largely unknown. The increasing number of blast cells in the bone marrow correlate with poor prognosis and risk of developing acute leukemia. Such progression is frequently associated with increasing chromosomal abnormalities and genetic mutations. A cohort of 75 MDS patients were investigated for RAS, FMS and p53 mutations, and these molecular findings were related to cytogenetics, clinical status, transformation to acute leukemia, prognostic scores and survival. A mutation incidence of 57% (43/75) was found, with 48% (36/75) RAS mutations, 12% (9/75) FMS mutations and 8% (4/50) p53 mutations. The mutation status for RAS and FMS was related to MDS subgroup, increasing with poor-risk disease. The highest incidence was in the chronic myelomonocytic leukemia (CMML) subgroup. The most frequent RAS mutations were of codon 12 and a predominance of FMS codon 969 mutations was observed. A statistically significant increased frequency of transformation to AML was observed in MDS patients harboring RAS or FMS mutations (P < 0.02). Patients with oncogene mutations had a significantly poorer survival compared with those without mutations at 2 years and at the end of the period of follow-up (P < 0.02). Multivariate analysis including mutation, age, gender, diagnosis (FAB), cytogenetics and International score shows that the International score and mutation and age is the best predictive model of a poor outcome, (P < 0.0001). When the analysis was undertaken without the International score, mutation and gender was the best predictor of poor survival (P = 0.005). This study shows that oncogene mutation, indicative of genetic instability, is associated with disease progression and poor survival in MDS.
 ...
PMID:RAS, FMS and p53 mutations and poor clinical outcome in myelodysplasias: a 10-year follow-up. 963 16

We analyzed the tumor suppressor gene product, p53, in elderly patients with myelodysplastic syndromes (MDS) and in overt leukemia patients after transformation from MDS using immunohistochemical techniques. We examined 52 MDS patients (mean age 79 years, range 68 to 96) from the time of initial diagnosis to death or development of overt leukemia. p53 protein was detected by immunohistochemistry (IHC) in 8/52 patients (15%) at initial diagnosis: 1/26 with refractory anemia (RA), 0/4 with RA with ringed sideroblasts, 3/11 with RA with an excess of blasts (RAEB), 3/8 with RAEB in transformation, and 1/3 with chronic myelomonocytic leukemia. We also analyzed gene mutations in patients with positive IHC. p53 mutations were detected in 3/8 (38%) patients. IHC-positive patients had a significantly higher incidence of leukemic transformation and the presence of a complex karyotype with monosomy 17. IHC-positive cells included blasts as well as mature myeloid cells, erythroblasts, and megakaryocytes. Scrutiny of our data in combination with previous data revealed that patients with positive IHC in multilineage cells were older than those in whom positivity was noted mostly in myeloblasts. This suggests that p53 IHC positivity with a multilineage pattern may be a characteristic of MDS in older patients.
 ...
PMID:Study of p53 in elderly patients with myelodysplastic syndromes by immunohistochemistry and DNA analysis. 1048 29

The ETV6 gene is a member of the ETS family of transcription factors and the main target of chromosomal rearrangements affecting chromosome band 12p13. To date, more than 15 fusion partners of ETV6 have been characterized at the molecular level. Most of these fusions encode chimeric proteins with oncogenic properties. However, some of the translocations do not produce a functional fusion protein, but may induce ectopic expression of oncogenes located close to the breakpoint. We herein report the characterization and cloning of a novel cryptic translocation, t(12;17)(p13;p12-p13), occurring in a patient with an acute myeloid leukemia evolving from a chronic myelomonocytic leukemia. Cytogenetic analysis suggested the presence of a deletion of the short arm of chromosome 12, del(12)(p13), in three of the five metaphase cells analyzed. However, fluorescence in situ hybridization (FISH) with the ETV6-specific cosmid clones 179A6, 50F4, 163E7, and 148B6 as well as probes hybridizing to the TP53 gene on 17p13 and the subtelomeric region of 17p revealed the presence of a translocation between 12p and 17p. By FISH, the breakpoints could be localized in intron 1 of ETV6 and centromeric to TP53. By 3' rapid amplification of cDNA ends-polymerase chain reaction (3' RACE-PCR), a fusion transcript between exon 1 of ETV6 and the antisense strand of PER1 (period homolog 1, Drosophila), a circadian clock gene, could be identified. This ETV6-PER1 (antisense PER1 strand) fusion transcript does not produce a fusion protein, and no other fusion transcripts could be detected. We hypothesize that in the absence of a fusion protein, the inactivation of PER1 or deregulation of a gene in the neighborhood of PER1 may contribute to the pathogenesis of leukemias with a t(12;17)(p13;p12-p13).
 ...
PMID:A novel cryptic translocation t(12;17)(p13;p12-p13) in a secondary acute myeloid leukemia results in a fusion of the ETV6 gene and the antisense strand of the PER1 gene. 1266 Oct 8

Oncogenic mutations in the KRAS2, NRAS, or FLT3 gene are detected in more than 50% of patients with de novo acute myeloid leukemia (AML). RAS mutations are also prevalent in de novo myelodysplastic syndrome (MDS), especially chronic myelomonocytic leukemia and juvenile myelomonocytic leukemia. However, few studies have examined these genetic lesions in therapy-related myeloid malignancies. Monosomy 7/del(7q) and monosomy 5/del(5q) represent the most common cytogenetic abnormalities in therapy-related MDS and AML (t-MDS/t-AML) and are strongly associated with prior exposure to alkylating agents. Mutational analysis of bone marrow specimens from a well-characterized cohort of 26 t-MDS/t-AML patients with abnormalities of chromosomes 5 and/or 7 revealed 3 with RAS mutations. Further analyses of 23 of these cases uncovered one FLT3 internal tandem duplication and five TP53 mutations. The four patients with RAS or FLT3 mutations had monosomy 7, including one with abnormalities of chromosomes 5 and 7. One specimen demonstrated mutations in both KRAS2 and TP53. RAS and FLT3 mutations, which are thought to stimulate the proliferation of leukemia cells, appear to be less common in t-MDS/t-AML than in de novo AML, whereas TP53 mutations are more frequent.
 ...
PMID:RAS, FLT3, and TP53 mutations in therapy-related myeloid malignancies with abnormalities of chromosomes 5 and 7. 1473 23

This study evaluates changes in genetic loci of chronic myeloid disorders using loss of heterozygosity (LOH) techniques. We present the combined results of three experiments. First, examination of a panel of genetic loci in groups of myeloproliferative disorders was evaluated. The second experiment involved microdissection of megakaryocytes from myeloproliferative disorders and comparison of their genetic changes to surrounding neoplastic marrow elements. Finally, we compared results of LOH studies of myeloproliferative disorders to those of myelodysplastic syndromes and chronic myelomonocytic leukemia. A total of 41 bone marrow biopsies were evaluated. Twenty-seven were myeloproliferative disorders (11 chronic idiopathic myelofibrosis, 11 essential thrombocythemia, 5 polycythemia vera). The remaining cases consisted of myelodysplastic syndromes (total=5; RAEB-1=2; RAEB-2=2; MDS, not otherwise specified=1) and chronic myelomonocytic leukemia (n=8). The abnormalities in myeloproliferative disorders were distributed as follows: D7S2554-4/14 (5/14); D8S263-4/15 (5/15); D9S157-5/15 (5/15); D9S161-7/17 (6/17); D13S319-5/14 (4/14); TP53-5/16 (5/16); D20S108-4/15 (4/15). In 75% cases diagnosed as essential thrombocythemia (6/8), both cases of polycythemia vera (2/2), and 29% cases of chronic idiopathic myelofibrosis (2/7), there were genetic differences between the megakaryocytes and the surrounding marrow. These results suggest that in some cases, megakaryocytes have different clonal abnormalities than surrounding hematopoietic tissue. The genetic profiles of myeloproliferative disorders had several differences from those of myelodysplastic syndromes. Although different from both, chronic myelomonocytic leukemia appeared more similar to myeloproliferative disorders using these techniques.
 ...
PMID:Loss of heterozygosity identifies genetic changes in chronic myeloid disorders, including myeloproliferative disorders, myelodysplastic syndromes and chronic myelomonocytic leukemia. 1770 56

RUNX1 encodes a DNA binding subunit of the core-binding transcription factors and is frequently mutated in acute leukemia, therapy-related leukemia, myelodysplastic syndrome, and chronic myelomonocytic leukemia. Mutations in RUNX1 are thought to confer upon hematopoietic stem cells (HSCs) a pre-leukemic state, but the fundamental properties of Runx1 deficient pre-leukemic HSCs are not well defined. Here we show that Runx1 deficiency decreases both apoptosis and proliferation, but only minimally impacts the frequency of long term repopulating HSCs (LT-HSCs). It has been variously reported that Runx1 loss increases LT-HSC numbers, decreases LT-HSC numbers, or causes age-related HSC exhaustion. We attempt to resolve these discrepancies by showing that Runx1 deficiency alters the expression of several key HSC markers, and that the number of functional LT-HSCs varies depending on the criteria used to score them. Finally, we identify genes and pathways, including the cell cycle and p53 pathways that are dysregulated in Runx1 deficient HSCs.
 ...
PMID:Runx1 loss minimally impacts long-term hematopoietic stem cells. 2214 44

Chronic myelomonocytic leukemia is a heterogeneous disease with multifactorial molecular pathogenesis. Various recurrent somatic mutations have been detected alone or in combination in chronic myelomonocytic leukemia. Recently, recurrent mutations in spliceosomal genes have been discovered. We investigated the contribution of U2AF1, SRSF2 and SF3B1 mutations in the pathogenesis of chronic myelomonocytic leukemia and closely related diseases. We genotyped a cohort of patients with chronic myelomonocytic leukemia, secondary acute myeloid leukemia derived from chronic myelomonocytic leukemia and juvenile myelomonocytic leukemia for somatic mutations in U2AF1, SRSF2, SF3B1 and in the other 12 most frequently affected genes in these conditions. Chromosomal abnormalities were assessed by nucleotide polymorphism array-based karyotyping. The presence of molecular lesions was correlated with clinical endpoints. Mutations in SRSF2, U2AF1 and SF3B1 were found in 32%, 13% and 6% of cases of chronic myelomonocytic leukemia, secondary acute myeloid leukemia derived from chronic myelomonocytic leukemia and juvenile myelomonocytic leukemia, respectively. Spliceosomal genes were affected in various combinations with other mutations, including TET2, ASXL1, CBL, EZH2, RAS, IDH1/2, DNMT3A, TP53, UTX and RUNX1. Worse overall survival was associated with mutations in U2AF1 (P=0.047) and DNMT3A (P=0.015). RAS mutations had an impact on overall survival in secondary acute myeloid leukemia (P=0.0456). By comparison, our screening of juvenile myelomonocytic leukemia cases showed mutations in ASXL1 (4%), CBL (10%), and RAS (6%) but not in IDH1/2, TET2, EZH2, DNMT3A or the three spliceosomal genes. SRSF2 and U2AF1 along with TET2 (48%) and ASXL1 (38%) are frequently affected by somatic mutations in chronic myelomonocytic leukemia, quite distinctly from the profile seen in juvenile myelomonocytic leukemia. Our data also suggest that spliceosomal mutations are of ancestral origin.
 ...
PMID:Spliceosomal gene mutations are frequent events in the diverse mutational spectrum of chronic myelomonocytic leukemia but largely absent in juvenile myelomonocytic leukemia. 2277 3


1 2 3 Next >>