Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P04637 (p53)
77,613 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We looked for MDM2 gene amplification and over-expression by Southern and Northern blot analysis in 135 and 66 cases of haematological malignancies, including ALL, AML, CML in chronic phase, CLL, MDS, PLL, non-Hodgkin's lymphoma (NHL) and myeloma. No amplification of the gene was found. An over-expression of MDM2 RNA was seen in 9/66 (14%) patients tested, including 3/9 ALL, 3/24 AML, 2/4 myelomas, 1/1 PLL, but 0/2 CML, 0/2 NHL and 0/21 MDS. None of the patients over-expressing MDM2 had modifications of P53 gene transcript or p53 mutations. Most of the patients over-expressing MDM2 gene had poor prognostic features (including 'unfavourable' cytogenetic abnormalities), poor response to chemotherapy and short survival. Our findings suggest that over-expression of MDM2 is seen in a relatively small number of haematological malignancies, and is associated with poor prognosis.
...
PMID:Over-expression of the MDM2 gene is found in some cases of haematological malignancies. 780 95

We have studied point mutations in exons 5-8 of the p53 gene in the myelodysplastic syndromes (MDS) by using polymerase chain reaction (PCR) single-strand conformation polymorphism (SSCP) analysis and direct nucleotide sequencing. The subtypes examined were: refractory anaemia (RA), refractory anaemia with ring sideroblasts (RARS), chronic myelomonocytic leukaemia (CMML), refractory anaemia with excess blasts (RAEB), refractory anaemia with excess blasts in transformation (RAEBt), and acute myeloid leukaemia (AML) which had evolved from MDS. 26 cases of MDS were studied. 12 of these were sequentially sampled but none changed its p53 status during the time of the study (18 months). Four mutations (one nonsense and three missense) were identified. Each case with a mutation was of an advanced MDS subtype, suggesting that p53 mutation in these diseases is a terminal genetic event in the process of leukaemogenesis. The nonsense mutation inserted a premature stop codon in a case of AML which had evolved from RAEB; this mutation has been reported before in both chronic myeloid leukaemia (CML) and Burkitt's lymphoma. The three missense mutations have not previously been reported in haematological malignancies.
...
PMID:p53 mutation in the myelodysplastic syndromes. 783 78

p53 protein expression has been investigated by immunohistochemistry in 58 patients with leukemia. Seven of 24 cases with acute myeloid leukemia (AML), 3 of 15 cases with chronic lymphocytic leukemia (CLL), one of 11 cases with chronic myeloid leukemia (CML) and 4 of 8 cases with acute lymphoid leukemia (ALL) had p53 protein expression. Of patients having p53 expression, one case with AML had refractory anemia with excess blasts-transformation (RAEB/t), one case with CLL had Richter's syndrome and another one with CML was in accelerated phase. Finally, 26% of leukemia cases had p53 protein expression. It may be concluded that p53 protein abnormalities may have an important role in leukomogenesis and in the development of more malignant clones in chronic leukemias.
...
PMID:p53 protein expression in leukemias. 786 30

Minute alterations of the p53 tumor suppressor gene and N-ras oncogene were investigated in 106 samples for the p53 gene and 23 samples for the N-ras gene obtained from patients with various types of hematologic malignancies using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and direct nucleotide sequencing. Mobility shifts suggesting sequence alteration were observed in 9 cases (8.5%) in exons 5 through 8 containing evolutionarily highly conserved regions of the p53 gene by PCR-SSCP; missense point mutations in 3 cases (1 acute myelogenous leukemia (AML), 1 chronic myelogenous leukemia (CML) in the accelerated phase, and 1 CML in the blast crisis), silent point mutation in 1 case (malignant lymphoma), and frame shift mutations due to insertions and deletions causing stop codons in 3 cases (1 AML, 1 CML in the chronic phase and 1 acute lymphoblastic leukemia (ALL)). p53 gene alterations did not always cluster within evolutionarily highly conserved regions, and there were various base change forms in cases with p53 point mutations. p53 mutations were detected in 2 cases out of 4 cases with 17 monosomy. There was no case with p53 gene alteration in myelodysplastic syndrome (MDS) cases. Mobility shifts suggesting sequence alteration were observed in 5 cases (22%) in exon 1 and 2 of the N-ras gene by PCR-SSCP. 3 cases (1 MDS, 1 MDS overt AML and 1 ALL) were detected to contain missense point mutations. However, simultaneous mutations in both the genes were detected in only 2 cases out of 23, thereby indicating infrequent occurrence of concomitant mutation of both the genes in hematologic malignancies. Alterations of the p53 and the N-ras genes are involved in the tumorigenesis, progression and prognosis of at least some cases of hematologic malignancies, in spite that they are relatively infrequent.
...
PMID:[Molecular study on minute alterations of the p53 and the N-ras genes in hematologic malignancies]. 792 79

Normal p53 protein suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of p53 decrease its antiproliferation function. In this work, we studied the requirement of the NH2- and COOH-terminal regions of p53 in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the NH2-terminus and deletion of 67 amino acids from the COOH-terminus of p53 drastically reduced the antiproliferation function of p53. However, the COOH-terminal deletion mutant is capable of binding to a p53 DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that p53' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.
...
PMID:The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function. 794 85

A patient with typical Ph1-positive CML was studied during sequential phases: (1) initial chronic phase, (2) first myeloid blast crisis, (3) second chronic phase, and (4) accelerated disease leading to a second blast crisis. A point mutation in codon 239 of the p53 gene and a novel chromosome 17 alteration appeared concomitantly with the first blast crisis and then disappeared with re-establishment of a second chronic phase. They did not reappear with the second acute phase, indicating that the clone responsible for the original blast crisis had been suppressed and supplanted by another clone of malignant cells. This observation suggests that in at least some CML patients drug therapy can suppress or eliminate an aggressive malignant cell clone, but that the underlying molecular defect in haemopoietic cells (in this case the c-ABL translocation) persists and other aggressive clones with different molecular lesions eventually arise. Our observations and inferences are consistent with the hypothesis advanced by Fialkow et al (1991) to explain clonal remissions in acute non-lymphocytic leukaemia.
...
PMID:Sequential relapses of blastic crisis may involve different clones of cells with different molecular abnormalities. 799 8

The tumor suppressor and transcriptional factor p53 is a phosphorylated protein. Its phosphorylation states are regulated by several protein kinases and phosphatases. In this study, the wild-type p53 was transfected and expressed in chronic myelogenous leukemia K-562 cells. Incubation of the transfected cells with okadaic acid, an inhibitor of serine phosphatases 2A and 1, induced hyperphosphorylation of p53 protein. The treatment also increased the steady state level of p53 protein in the cells. However, the hyperphosphorylated p53 protein was less active in promoting transcription mediated by two p53-binding DNA elements, the ribosomal gene cluster and the p53 consensus DNA-binding sequence. Nevertheless, the decreased transcription activation was not due to decreased binding of p53 to these elements, as analyzed by mobility shift DNA-binding assays. In addition, the treatment did not induce a conformational change in p53, as assayed by two conformation-specific anti-p53 monoclonal antibodies, PAb240 and PAb1620. These results suggest that the phosphorylation induced by okadaic acid may selectively modulate the transcription activation function of p53. Consequently, phosphorylation may represent a mechanism of p53 inactivation in tumor cells that harbor the wild-type p53.
...
PMID:Hyperphosphorylation of p53 induced by okadaic acid attenuates its transcriptional activation function. 804 94

The use of antisense oligonucleotides as a therapeutic tool in modulating gene expression represents a newly established strategy for treating diseases. Such oligomers may be designed to complement a region of a specific gene or messenger RNA. Using this approach, oligonucleotides can serve as a potential block of transcription or translation through sequence-specific hybridization with targeted genetic segments. In the Fourth Meeting of the Italian Society of Experimental Hematology "Discutiamone Insieme", authors reported the use of in vitro synthesized oligonucleotides to inhibit normal and chimeric gene expression of bcl-2 in normal and neoplastic cell lines, respectively, that carry the t(14;18) translocation. The roles of c-myb and B-myb in the control of the proliferation and differentiation of normal hematopoietic cell lines have been investigated by selective inhibition of the expression of specific transcripts. To get some insight into the correlation between proliferation and differentiation in myeloid cells, some authors studied and reported the differentiation potential of G1-arrested cells obtained by a specific oligodeoxynucleotide complementary to the 5' region of the c-myb mRNA. The use of anti-P53 antisense oligos in the modulation of the growth of normal and neoplastic bone marrow progenitors was presented and confirmed the pivotal role of this gene in cell cycle control. The role of abl gene expression in normal and chronic myelogenous leukemia (CML) cells is not yet completely understood. Selective inhibition of this proto-oncogene and of the abl-bcr oncogene have been achieved by using of c-abl sequence specific antisense oligonucleotides; this approach sheds new light on the function of this gene in CML.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Meeting report: antisense oligonucleotides. 806 71

We have investigated the involvement of the p53 and RB1 tumor-suppressor genes in 26 cases of chronic myeloid leukemia (CML) blast crisis, including 17 myeloid, eight lymphoid, and one megakaryoblastic crisis. The presence of p53 mutations in exons 5 through 9 was tested by the PCR-single-strand conformation polymorphism (SSCP) assay, followed by PCR-direct sequencing; in addition, loss of heterozygosity (LOH) at 17p13, the site of the p53 gene, was assayed by Southern blot. Given the variability of the mechanisms of inactivation of the RB1 gene in human tumors, a combination of Southern blot and mutational analysis by PCR-SSCP was used. p53 mutations were restricted to one case of myeloid blast crisis, showing a CGC-->TGC (Arg-->Cys) mutation at codon 283; two additional cases displayed LOH at 17p13 in the absence of p53 mutations. No molecular lesions of the RB1 gene were detected in any of the cases analyzed. These data indicate that inactivation of p53 and RB1 is a rare event in the molecular pathogenesis of CML acute transformation.
...
PMID:Genetic analysis of p53 and RB1 tumor-suppressor genes in blast crisis of chronic myeloid leukemia. 811 Aug 76

We have investigated the involvement of tumor suppressor genes (p53 and RB1) and dominantly acting oncogenes (Ras family genes) in BCR/ABL positive and negative chronic myeloproliferative disorders (CMPD) at different stages of the disease, including 26 cases of BCR/ABL+ chronic myeloid leukemia (CML) blast crisis, 9 myelosclerosis with myeloid metaplasia, 4 polycythemia vera, 10 essential thrombocythemia, 1 juvenile CML, and 8 BCR/ABL- CML. The presence of mutations in p53 exons 5 through 9, as well as in RB1 exons 10-27 and in N-, K-, H-Ras exons 1 and 2 was tested by the PCR-Single Strand Conformation Polymorphism technique and by PCR-Direct Sequencing. In addition, Southern blot analysis was used to investigate the occurrence of gross rearrangements in the p53 gene as well as loss of heterozygosity at 17p13, the site of p53. Acute phase BCR/ABL-CMPD cases displayed a high frequency of p53 (2/7) and Ras (3/7) lesions, whereas BCR/ABL- CMPD in chronic phase displayed only germline p53 and Ras sequences. Conversely, p53 inactivation was restricted to only 1/26 cases of BCR/ABL+ CML blast crisis. No alterations in the RB1 gene were detected in any of the cases analyzed. These data indicate that p53 inactivation and/or Ras activation might play a role in acute transformation of BCR/ABL- CMPD and that the molecular mechanisms of tumor progression may be different in BCR/ABL+ versus BCR/ABL-CMPD.
...
PMID:Molecular mechanisms of tumor progression in chronic myeloproliferative disorders. 815


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>